Author Details

[Do not use this base pattern directly: see the following variants of this pattern for usage]

Author Details Group

ICGC Chronic Myeloid Disorders Group

  1. Cancer Genome Project, Wellcome Trust Sanger Institute, Hinxton, United Kingdom
Competing interests
No competing interests declared
  1. Luca Malcovati, Fondazione IRCCS Policlinico San Matteo, University of Pavia, Pavia, Italy
  2. Sudhir Tauro, Division of Medial Sciences, University of Dundee, Dundee, UK
  3. Jacqueline Boultwood, Nuffield Department of Clinical Laboratory Sciences, University of Oxford, UK

Author Details Person

Jenny Bloggs

  1. Evolutionary Studies Institute and Centre of Excellence in PalaeoSciences, University of the Witwatersrand, Johannesburg, South Africa
  2. School of Geosciences, University of the Witwatersrand, Johannesburg, South Africa
Present addresses
  1. Department of Inventive Inventions, Univertity of Wessex, Windowchester, Wessex
  2. Department of Underwater Basket Weaving, University of Somewhere
Contribution
Conception and design, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article, Contributed unpublished essential data or reagents
Contributed equally with
  1. Francesca Smith
  2. Wendel Jakes III
For correspondence
  1. jenny@bloggs.com
  2. +1 555-4321-09876
Competing interests
No competing interests declared
ORCID icon 0000-0002-3400-7927

Author Details Sub Group

ICGC Chronic Myeloid Disorders Group

  1. Cancer Genome Project, Wellcome Trust Sanger Institute, Hinxton, United Kingdom
Competing interests
No competing interests declared
Sub-group 1
  1. Luca Malcovati, Fondazione IRCCS Policlinico San Matteo, University of Pavia, Pavia, Italy
  2. Sudhir Tauro, Division of Medial Sciences, University of Dundee, Dundee, UK
Sub-group 2
  1. Jacqueline Boultwood, Nuffield Department of Clinical Laboratory Sciences, University of Oxford, UK

Button

Button Extra Small

Button Full

Button Inactive

Button Login

Button Outline

Button Reversed Extra Small

Button Reversed Inactive

Button Reversed Small

Button Reversed

Button Small

Caption Text

[Do not use this base pattern directly: see the following variants of this pattern for usage]

Caption Text Additional Asset

Table 1 - source data 1.

Is the species name mentioned in the title, impact statement, abstract and digest of eLife papers (July–Sept 2014)?

some more details here

Caption Text Captioned Asset

Many features are conserved between the mammalian nephron and planarian protonephridia.

(A) Image of a young adult C. elegans and schematic depicting the twelve pairs of sensory neurons in the anterior amphid individuals carrying a virus with k deleterious mutations at its endemic equilibrium. class carrying the fewest number of deleterious mutations is defined as mutation class k = 0. Inset: variation in the basic reproductive rate of infected individuals (gray histogram) and variation in the net reproductive rate R of infected individuals (brown histogram) resulting from variation in the number of deleterious mutations carried by circulating viruses.

Listed are, for each triplet of cell types, the probabilities of the four topologies for prior odds p(βi=1)p(βi=0)=0.05; the number of topologies that reach probability p(T | {giA,B,C})>0.6 for some value of p(βi=1)p(βi=0) between 10−6 and 102; the non-null topology that has the highest probability p(T | {giA,B,C}) over the range of prior odds (if the null topology is the most likely topology for the entire range of prior odds, the topology is marked ‘null’); and the value of highest probability p(T | {giA,B,C}) over the range of prior odds; the correct topology and triplet length in the traditional model; and the correct topology and triplet length in the Adolfsson model.

(A) Doxycycline-inducible gam-gfp fusion construct in the E. coli chromosome. Constitutively produced TetR protein represses the PN25tetO promoter, which produces GamGFP upon doxycycline induction. oriC, origin of replication; ter, replication terminus; arrows, directions of transcription. (B) Phage λ assay for end-blocking activity by Mu Gam and GamGFP. Rolling-circle replication of phage λred gam is inhibited by E. coli RecBCD, which causes small plaques of λred gam on wild-type E. coli (Smith, 1983). Mu Gam protein binds and protects DNA ends from RecBCD exonuclease activity (Akroyd and Symonds, 1986) and so is expected to allow rolling-circle replication of λred gam and therefore allow formation of large plaques. (C) λred gam plaques are small on recB+ (WT) and large on recB-deficient cells (recB-). Plaques produced on WT cells carrying gam and gam-gfp are small when Gam and GamGFP proteins are not produced (Uninduced). (D) λred gam produce large plaques on WT cells if Gam or GamGFP are produced (Induced). (E) UV sensitivity of E. coli recB-null mutant compared with recB+(WT), and uninduced gam and gam-gfp carrying cells. WT (), recB (), WT GamGFP, (); WT Gam, (). (F) Induction of Gam or GamGFP with 200 ng/ml doxycycline causes UV sensitivity similar to that of recB-null mutant cells, indicating that Gam or GamGFP block RecBCD action on double-stranded DNA ends. WT, SMR14327; recB, SMR8350; WT GamGFP, SMR14334; WT Gam, SMR14333. Representative experiment performed three times with comparable results.

Code

<dock_design>
  <SCOREFXNS>
    <fullatom weights=beta symmetric = 0> </fullatom> 
  </SCOREFXNS> 
  <!-- Longabadaliasametatquedoloreaqueesthicillabadaliasametatquedoloreaqueesthicillabadaliasametatquedoloreaqueesthicillolong --> 
  <FILTERS> 
    <Ddg name=ddg scorefxn=fullatom threshold = 0 jump = 1 repeats = 1 repack = 1 confidence = 1/>
    <Sasa name=sasa confidence = 0/>
    <ShapeComplementarity name=shape verbose = 1 confidence = 0 jump = 1/> 
  </FILTERS>
  <MOVERS>
    <AtomTree name=docking_tree docking_ft = 1/>
    <DockSetupMover name=setup_dock/>
    <DockingProtocol name=dock docking_score_high=fullatom low_res_protocol_only = 0 docking_local_refine = 0 dock_min = 1 />
  </MOVERS>
  <APPLY_TO_POSE>
  </APPLY_TO_POSE> 
  <PROTOCOLS> 
    <Add mover_name=docking_tree/> 
    <Add mover_name=setup_dock/> 
    <Add mover_name=dock/> 
    <Add filter_name=ddg/> 
    <Add filter_name=sasa/> 
    <Add filter_name=shape/> 
  </PROTOCOLS> 
</dock_design>

Date

Date Expanded

Date Updated

Updated

Definition List

Research focus
Pre-mRNA splicing
post-transcriptional gene regulation
Experimental organism
Human
Mouse

Definition List Inline

Research focus
Pre-mRNA splicing
post-transcriptional gene regulation
Experimental organism
Human
Mouse

Doi

https://doi.org/10.7554/eLife.16370

Doi Article Section

https://doi.org/10.7554/eLife.16370

Doi Asset

https://doi.org/10.7554/eLife.16370

Doi Truncated

doi: 10.7554/eLife.16370

Iframe

Info Bar

You may want to consider this

Info Bar Attention

Please complete the following tasks

Info Bar Correction Notice

This is a correction notice; read the corrected article Article

Info Bar Multiple Versions

Read the most recent version of this article

Info Bar Success

Operation completed successfully

Lead Para

eLife publishes research covering virology and bacterial and fungal pathogens. Decisions are made by journal editors who are active researchers in the field.

List Heading

Podcasts

List

  • item 1
  • item 2

List Bullet

  • item 1
  • item 2

List Numbers

  1. item 1
  2. item 2

List Roman

  1. item 1
  2. item 2

List Teaser

Math

Body Mass=0.060×FSTpr+13.856,SEE=6.78,r=0.50,p=<0.001.

Math Long

(7) y=β0+β1Choice+β2SVspend+β3SVsave+β4SeqSV+β5SeqLength+β6Cueposition+β7Left/right+β8Sequenceprogress+ϵ,

Math With Label

(10) SVsaven= 1mni=n+1mSVspendi,

Media Source

Message Bar

1824 results found

Nav Linked Item

Orcid

ORCID icon 0000-0002-3400-7927

Paragraph

Some text in a paragraph element

Picture

Meaningful alt text here please.

Picture Svg With Fallback

Meaningful alt text here please.

Social Media Sharers

Speech Bubble

Speech Bubble Has Placeholder Disabled

Speech Bubble Has Placeholder

Speech Bubble Small Disabled

Speech Bubble Small Is Loading

Speech Bubble Small

Table

F(Dfn, Dfd)F(Dfn, Dfd)F(Dfn, Dfd)F(Dfn, Dfd)F(Dfn, Dfd)F(Dfn, Dfd)F(Dfn, Dfd)F(Dfn, Dfd)F(Dfn, Dfd)Partial η2Original effect size fReplication total sample sizeDetectable effect size f
F(24,39) = 0.8678 (interaction)0.3481200.7307699169*0.3895070
F(2,39) = 0.8075 (treatments)0.0397660.20350141690.2415459
F(12,39) = 187.6811 (hematology parameters)0.9829787.599178169*0.3331365
F(Dfn, Dfd)F(Dfn, Dfd)F(Dfn, Dfd)F(Dfn, Dfd)F(Dfn, Dfd)F(Dfn, Dfd)F(Dfn, Dfd)F(Dfn, Dfd)F(Dfn, Dfd)Partial η2Original effect size fReplication total sample sizeDetectable effect size f
F(24,39) = 0.8678 (interaction)0.3481200.7307699169*0.3895070
F(2,39) = 0.8075 (treatments)0.0397660.2035014169*0.2415459
F(12,39) = 187.6811 (hematology parameters)0.9829787.599178169*0.3331365
  1. *

    Footnote 1.

  2. The values in parenthesis refer to the highest resolution shell.

    *Rmerge=hkli|I(hkl;i)<I(hkl)>|hkli(hkl;i) where I(hkl;i) is the intensity of an individual measurement of a reflection and <I(hkl)> is the average intensity of that reflection.

Video

Client Error

Say what?

Your browser sent us something unexpected.
We’ve logged the problem and will look into it.

Not Found

Oops!

The page you were looking for is not found.

Not Found Button

Oops!

The page you were looking for is not found.

Back to home

Server Error

Kabooooooom!

Something has gone seriously wrong.
We’ve logged the problem and will look into it.

Service Unavailable

Back soon

We’re carrying out planned maintenance on this page.

Hidden Field

Honeypot

Select

Select Error

Please provide a valid value

Select Info Error

You may wish to consider this
Please provide a valid value

Select Info Valid

Hunky dory, thanks very much

Select Info

You may wish to consider this

Select Valid

Text Area

Text Area Error

Please provide a valid value

Text Area Info Error

You may wish to consider this
Please provide a valid value

Text Area Info Valid

Hunky dory, thanks very much

Text Area Info

You may wish to consider this

Text Area Valid

Text Field

Text Field Error

Please provide a valid value

Text Field Info Error

You may wish to consider this
Please provide a valid value

Text Field Info Valid

Hunky dory, thanks very much

Text Field Info

You may wish to consider this

Text Field Valid

Reference

[Do not use this base pattern directly: see the following variants of this pattern for usage]

Reference Book Chapter

Understanding the rhythm of breathing: so near, yet so far
  1. JL Feldman
  2. C Del Negro
  3. PA Gray
(2013)
In: Julius D, Clapham DE, editors. Annual Review of Physiology 75:423–452.
https://doi.org/10.1146/annurev-physiol-040510-130049

Reference Book

Philosophie Anatomique
  1. Geoffroy Saint-Hilaire E.
(1818)
Paris: Méquignon-Marvis

Reference Clinical Trial

Scripps Wired for Health Study (Registration: 000000)
Scripps Translational Science Institute (sponsor) (2015)

Reference Conference Proceeding

Boundary learning by optimization with topological constraints
  1. BV Jain
  2. B Bollman
  3. M Richardson
  4. DR Berger
  5. MN Helmstaedter
  6. KL Briggman
  7. W Denk
  8. JB Bowden
  9. JM Mendenhall
  10. WC Abraham
  11. KM Harris
  12. N Kasthuri
  13. KJ Hayworth
  14. R Schalek
  15. JC Tapia
  16. JW Lichtman
  17. HS Seung
(2010)
Boundary learning by optimization with topological constraints, IEEE Conference on Computer Vision and Pattern Recognition (CVPR)

Reference Data

NKX2-5 mutations causative for congenital heart disease retain functionality and are directed to hundreds of targets
  1. R Bouveret
  2. R Bouveret
  3. N Schonrock
  4. M Ramialison
  5. T Doan
  6. D de Jong
  7. A Bondue
  8. G Kaur
  9. S Mohamed
  10. H Fonoudi
  11. C Chen
  12. M Wouters
  13. S Bhattacharya
  14. N Plachta
  15. SL Dunwoodie
  16. G Chapman
  17. C Blanpain
  18. RP Harvey
(2015)
NCBI Gene Expression Omnibus. Series accession number GSE44902

Reference Journal Article

Oldest Homo and Pliocene biogeography of the Malawi rift
  1. Schrenk F
  2. Bromage TG
  3. Betzler CG
  4. Ring U
  5. Juwayeyi YM
(1993)
Nature 365:833–836. PMID 8413666
https://doi.org/10.1038/365833a0

Reference Patent

IRE-1alpha inhibitors (US20100941530)
  1. JB Patterson
  2. DG Lonergan
  3. GA Flynn
  4. Z Qingpeng
  5. PV Pallai
(2011)
Mankind Corp, United States patent, United States

Reference Periodical

Unreliable research: Trouble at the lab
  1. The Economist
(October 19, 2013)
The Economist, p26–30.

Reference Preprint

Reference Report

Educational Excellence Everywhere
  1. Department of Education, UK.
(2016)
London: HMSO

Reference Software

The Pymol Molecular Graphics System
  1. W. L. DeLano
(2002)
DeLano Scientific, Palo Alto, CA

Reference Thesis

Theory of large fluctuations in stochastic populations
  1. Assaf M.
(2010)
Hebrew University of Jerusalem

Reference Web

The Problem of Perception
  1. Crane T
(2005)
The Stanford Encyclopedia of Philosophy

About Profile

Randy Scheckman

Editor-in-Chief

Lorem ipsum dolor sit amet, consectetur adipiscing elit. Mauris tempor euismod mi. Morbi facilisis eros in mi consequat cursus. Nulla malesuada pretium mauris, vitae gravida diam laoreet ac. Curabitur ornare libero sed porta molestie. Ut ut sem in libero tincidunt lobortis. Nullam eros nisi, malesuada vitae leo sit amet, bibendum congue justo. Morbi iaculis lectus erat, vel dapibus metus posuere sit amet. Phasellus eget scelerisque massa. Mauris hendrerit ex in nisl ultricies elementum. Donec tellus risus, rhoncus molestie rutrum et, cursus eget mi. Praesent et elit tellus. Curabitur id sodales turpis. Fusce pulvinar aliquam commodo. Cras vitae dolor vitae metus dignissim auctor.Cras nulla purus, rhoncus et mollis in, imperdiet sed metus. In non porttitor nibh. In sit amet ipsum eget nisl laoreet tincidunt. Donec iaculis nibh quis lacus viverra sagittis. Phasellus imperdiet congue imperdiet.

Interdum et malesuada fames ac ante ipsum primis in faucibus. Nunc nisi tortor, rhoncus.

Expertise
Cell Biology
Competing interests statement
Donec tellus

Additional Asset

[Do not use this base pattern directly: see the following variants of this pattern for usage]
.

Additional Asset Doi

Table 1 - source data 1.

Is the species name mentioned in the title, impact statement, abstract and digest of eLife papers (July–Sept 2014)?

some more details here
https://doi.org/10.7554/eLife.10181.001

Additional Asset Non Doi

Table 1 - source data 1.

Is the species name mentioned in the title, impact statement, abstract and digest of eLife papers (July–Sept 2014)?

some more details here
https://example.com/a-non-doi-link

Article Download Links List

A three part list of links to download the article, or parts of the article, in various formats.

Downloads (links to download the article or parts of the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)

Article Meta

Article Section Kitchen Sink

The Kitchen Sink

Heading 1

Heading 2

Heading 3

Heading 4

Heading 5
Heading 6

This is not wrapped in a paragraph.

This is in a paragraph. Lorem ipsum dolor sit amet, test link adipiscing elit. This is strong. Nullam dignissim convallis est. This is underlined. Quisque aliquam. This is emphasized. Donec faucibus. This is monospace. Nunc iaculis suscipit dui. 53 = 125. Water is H2O. Nam sit amet sem. This is in small caps. Aliquam libero nisi, imperdiet at, tincidunt nec, gravida vehicula, nisl. The New York Times (That’s a citation). This is blue. Maecenas ornare tortor. This is purple. Donec sed tellus eget sapien fringilla nonummy. This is red. Mauris a ante. Suspendisse quam sem, consequat at, commodo vitae, feugiat in, nunc. Morbi imperdiet augue quis tellus.

HTML and CSS are our tools. Mauris a ante. Suspendisse quam sem, consequat at, commodo vitae, TAATAAGGAAGAACTGCTTATTCTTAATTATTTCTACCTACTAAACTAACTAATTATCAACAAATATCATCTATTTAATAGTATATCATCACATGCGGTGTAAGAGGATGACATAAAGATTGAGAAACAGTCATCCAGTCTAATGGAAGCTCAAATGCAAGGGCTGATAATGTAATAGGATAATGAATGACAACGTATAAAAGGAAAGAAGATAAAGCAATATTATTTTGTAGAATTATCGATTCCCTTTTGTGGATCCCTATATCCTCGAGGAGAA feugiat in, nunc. Morbi imperdiet augue quis tellus. Praesent mattis, massa quis luctus fermentum, turpis mi volutpat justo, eu volutpat enim diam eget metus. To copy a file type COPY filename. Dinner’s at 5:00. Let’s make that 7. This text has been struck.


List Types

Definition List

Definition List Title
This is a definition list division.
Definition
An exact statement or description of the nature, scope, or meaning of something: our definition of what constitutes poetry.

Ordered List

  1. List Item 1
  2. List Item 2
    1. Nested list item A
    2. Nested list item B
  3. List Item 3

Unordered List

  • List Item 1
  • List Item 2
    • Nested list item A
    • Nested list item B
  • List Item 3

Table

Table Header 1 Table Header 2 Table Header 3 Table Header 4
Division 1 Division 2 Division 3 Division 4
Division 1 Division 2 Division 3 Division 4
Division 1 Division 2 Division 3 Division 4
This is blue. This is green. This is orange. This is yellow.
This is purple. This is red. This is pink. This is grey.

Preformatted Text

Typographically, preformatted text is not the same thing as code. Sometimes, a faithful execution of the text requires preformatted text that may not have anything to do with code. Most browsers use Courier and that’s a good default — with one slight adjustment, Courier 10 Pitch over regular Courier for Linux users. For example:

“Beware the Jabberwock, my son!
  The jaws that bite, the claws that catch!
Beware the Jubjub bird, and shun
  The frumious Bandersnatch!”

Code

Code can be presented inline, like <?php bloginfo('stylesheet_url'); ?>, or within a <pre> block. Because we have more specific typographic needs for code, we’ll specify Consolas and Monaco ahead of the browser-defined monospace font.

#container {
  float: left;
  margin: 0 -240px 0 0;
  width: 100%;
}
    

Blockquotes

Let’s keep it simple. Italics are good to help set it off from the body text. Be sure to style the citation.

Good afternoon, gentlemen. I am a HAL 9000 computer. I became operational at the H.A.L. plant in Urbana, Illinois on the 12th of January 1992. My instructor was Mr. Langley, and he taught me to sing a song. If you’d like to hear it I can sing it for you.

— Citing HAL 9000

And here’s a bit of trailing text.

Article Section

Introduction

TNF Receptor Associated Factor 2 (TRAF2) is an adaptor protein that transduces signals following ligation of certain cytokine receptors including those binding TNF. It was first identified together with TRAF1 as a component of TNF receptor-2 and then TNF receptor-1 (TNFR1) signalling complexes (Rothe et al., 1994; Shu et al., 1996). TRAF2, like most other TRAFs, contains a RING domain, several zinc fingers, a TRAF-N, and a conserved TRAF-C domain which is responsible for oligomerisation and receptor binding through its MATH region (Takeuchi et al., 1996; Uren and Vaux, 1996).

RING domains are nearly always associated with ubiquitin E3 ligase activity (Shi and Kehrl, 2003) and TRAF2 can promote ubiquitylation of RIPK1 in TNFR1 signalling complexes (TNFR1-SC) (Wertz et al., 2004). However TRAF2 recruits E3 ligases such as cIAPs to TNFR1-SC and these have also been shown to be able to ubiquitylate RIPK1 and regulate TNF signalling (Dynek et al., 2010; Mahoney et al., 2008; Varfolomeev et al., 2008; Vince et al., 2009). This makes it difficult to unambiguously determine the role of the E3 ligase activity of TRAF2.

Activation of JNK and NF-κB by TNF is reduced in cells from Traf2-/- mice while only JNK signalling was affected in lymphocytes from transgenic mice that express a dominant negative (DN) form of TRAF2 that lacks the RING domain (Lee et al., 1997; Yeh et al., 1997). Traf2-/-Traf5-/- mouse embryonic fibroblasts (MEFs) have a pronounced defect in activation of NF-κB by TNF, suggesting that absence of TRAF2 can be compensated by TRAF5 (Tada et al., 2001). Although activation of NF-κB was restored in Traf2-/-Traf5-/- cells by re-expression of wild type TRAF2, it was not restored when the cells were reconstituted with TRAF2 point mutants that could not bind cIAPs (Vince et al., 2009; Zhang et al., 2010). These data, together with a wealth of different lines of evidence showing that cIAPs are critical E3 ligases required for TNF-induced canonical NF-κB (Blackwell et al., 2013; Haas et al., 2009; Silke, 2011), support the idea that the main function of TRAF2 in TNF-induced NF-κB is to recruit cIAPs to the TNFR1-SC. However, it remains possible that the RING of TRAF2 plays another function, such as in activating JNK and protecting cells from TNF-induced cell death (Vince et al., 2009; Zhang et al., 2010). Furthermore it has been shown that TRAF2 can K48-ubiquitylate caspase-8 to set the threshold for TRAIL or Fas induced cell death (Gonzalvez et al., 2012). Moreover, TRAF2 inhibits non-canonical NF-κB signalling (Grech et al., 2004; Zarnegar et al., 2008) and this function requires the RING domain of TRAF2 to induce proteosomal degradation of NIK (Vince et al., 2009). However, structural and in vitro analyses indicate that, unlike TRAF6, the RING domain of TRAF2 is unable to bind E2 conjugating enzymes (Yin et al., 2009), and is therefore unlikely to have intrinsic E3 ligase activity.

Sphingosine-1-phosphate (S1P) is a pleiotropic sphingolipid mediator that regulates proliferation, differentiation, cell trafficking and vascular development (Pitson, 2011). S1P is generated by sphingosine kinase 1 and 2 (SPHK1 and SPHK2) (Kohama et al., 1998; Liu et al., 2000). Extracellular S1P mainly acts by binding to its five G protein-coupled receptors S1P1-5 (Hla and Dannenberg, 2012). However, some intracellular roles have been suggested for S1P, including the blocking of the histone deacetylases, HDAC1/2 (Hait et al., 2009) and the induction of apoptosis through interaction with BAK and BAX (Chipuk et al., 2012).

Recently, it was suggested that the RING domain of TRAF2 requires S1P as a co-factor for its E3 ligase activity (Alvarez et al., 2010). Alvarez and colleagues proposed that SPHK1 but not SPHK2 is activated by TNF and phosphorylates sphingosine to S1P which in turn binds to the RING domain of TRAF2 and serves as an essential co-factor that was missing in the experiments of Yin et al. Alvarez and colleagues, observed that in the absence of SPHK1, TNF-induced NF-κB activation was completely abolished.

Although we know a lot about TRAF2, there are still important gaps particularly with regard to cell type specificity and in vivo function of TRAF2. Moreover, despite the claims that SPHK1 and its product, S1P, are required for TRAF2 to function as a ubiquitin ligase, the responses of Traf2-/- and Sphk1-/- cells to TNF were not compared. Therefore, we undertook an analysis of TRAF2 and SPHK1 function in TNF signalling in a number of different tissues.

Surprisingly, we found that neither TRAF2 nor SPHK1 are required for TNF mediated canonical NF-κB and MAPK signalling in macrophages. However, MEFs, murine dermal fibroblasts (MDFs) and keratinocytes required TRAF2 but not SPHK1 for full strength TNF signalling. In these cell types, absence of TRAF2 caused a delay in TNF-induced activation of NF-κB and MAPK, and sensitivity to killing by TNF was increased. Absence of TRAF2 in keratinocytes in vivo resulted in psoriasis-like epidermal hyperplasia and skin inflammation. Unlike TNF-dependent genetic inflammatory skin conditions, such as IKK2 epidermal knock-out (Pasparakis et al., 2002) and the cpdm mutant (Gerlach et al., 2011), the onset of inflammation was only delayed, and not prevented by deletion of TNF. This early TNF-dependent inflammation is caused by excessive apoptotic but not necroptotic cell death and could be prevented by deletion of Casp8. We observed constitutive activation of NIK and non-canonical NF-κB in Traf2-/- keratinocytes which caused production of inflammatory cytokines and chemokines. We were able to reverse this inflammatory phenotype by simultaneously deleting both Tnf and Nfkb2 genes. Our results highlight the important role TRAF2 plays to protect keratinocytes from cell death and to down-regulate inflammatory responses and support the idea that intrinsic defects in keratinocytes can initiate psoriasis-like skin inflammation.

https://doi.org/10.7554/eLife.16370

Audio Player

Authors Details

Author details

  1. Jenny Bloggs

    1. Evolutionary Studies Institute and Centre of Excellence in PalaeoSciences, University of the Witwatersrand, Johannesburg, South Africa
    2. School of Geosciences, University of the Witwatersrand, Johannesburg, South Africa
    Present addresses
    1. Department of Inventive Inventions, Univertity of Wessex, Windowchester, Wessex
    Contribution
    Conception and design, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article, Contributed unpublished essential data or reagents
    For correspondence
    1. jenny@bloggs.com
    2. +1 555-4321-09876
    Competing interests
    No competing interests declared
    ORCID icon 0000-0002-3400-7927
  2. ICGC Chronic Myeloid Disorders Group

    1. Cancer Genome Project, Wellcome Trust Sanger Institute, Hinxton, United Kingdom
    Competing interests
    No competing interests declared
    1. Luca Malcovati, Fondazione IRCCS Policlinico San Matteo, University of Pavia, Pavia, Italy
    2. Sudhir Tauro, Division of Medial Sciences, University of Dundee, Dundee, UK
    3. Jacqueline Boultwood, Nuffield Department of Clinical Laboratory Sciences, University of Oxford, UK

Bar Chart

Button Collection

  1. Button 1
  2. Button 2
  3. Button 3

Button Collection Centered

  1. Button 1
  2. Button 2
  3. Button 3

Button Collection Compact

  1. Button 1
  2. Button 2
  3. Button 3

Captioned Asset

[Do not use this base pattern directly: see the following variants of this pattern for usage]

Captioned Asset Iframe

Many features are conserved between the mammalian nephron and planarian protonephridia.

(A) Image of a young adult C. elegans and schematic depicting the twelve pairs of sensory neurons in the anterior amphid individuals carrying a virus with k deleterious mutations at its endemic equilibrium. class carrying the fewest number of deleterious mutations is defined as mutation class k = 0. Inset: variation in the basic reproductive rate of infected individuals (gray histogram) and variation in the net reproductive rate R of infected individuals (brown histogram) resulting from variation in the number of deleterious mutations carried by circulating viruses.

https://doi.org/10.7554/eLife.16370

Captioned Asset Image

Meaningful alt text here please.
Many features are conserved between the mammalian nephron and planarian protonephridia.

(A) Image of a young adult C. elegans and schematic depicting the twelve pairs of sensory neurons in the anterior amphid individuals carrying a virus with k deleterious mutations at its endemic equilibrium. class carrying the fewest number of deleterious mutations is defined as mutation class k = 0. Inset: variation in the basic reproductive rate of infected individuals (gray histogram) and variation in the net reproductive rate R of infected individuals (brown histogram) resulting from variation in the number of deleterious mutations carried by circulating viruses.

https://doi.org/10.7554/eLife.16370

Captioned Asset Inline Image

Meaningful alt text here please.
Many features are conserved between the mammalian nephron and planarian protonephridia.

(A) Image of a young adult C. elegans and schematic depicting the twelve pairs of sensory neurons in the anterior amphid individuals carrying a virus with k deleterious mutations at its endemic equilibrium. class carrying the fewest number of deleterious mutations is defined as mutation class k = 0. Inset: variation in the basic reproductive rate of infected individuals (gray histogram) and variation in the net reproductive rate R of infected individuals (brown histogram) resulting from variation in the number of deleterious mutations carried by circulating viruses.

https://doi.org/10.7554/eLife.16370

Captioned Asset Picture

Meaningful alt text here please.
Many features are conserved between the mammalian nephron and planarian protonephridia.

(A) Image of a young adult C. elegans and schematic depicting the twelve pairs of sensory neurons in the anterior amphid individuals carrying a virus with k deleterious mutations at its endemic equilibrium. class carrying the fewest number of deleterious mutations is defined as mutation class k = 0. Inset: variation in the basic reproductive rate of infected individuals (gray histogram) and variation in the net reproductive rate R of infected individuals (brown histogram) resulting from variation in the number of deleterious mutations carried by circulating viruses.

https://doi.org/10.7554/eLife.16370

Captioned Asset Table

Many features are conserved between the mammalian nephron and planarian protonephridia.

(A) Image of a young adult C. elegans and schematic depicting the twelve pairs of sensory neurons in the anterior amphid individuals carrying a virus with k deleterious mutations at its endemic equilibrium. class carrying the fewest number of deleterious mutations is defined as mutation class k = 0. Inset: variation in the basic reproductive rate of infected individuals (gray histogram) and variation in the net reproductive rate R of infected individuals (brown histogram) resulting from variation in the number of deleterious mutations carried by circulating viruses.

https://doi.org/10.7554/eLife.16370
F(Dfn, Dfd)Partial η2Original effect size fReplication total sample sizeDetectable effect size f
F(24,39) = 0.8678 (interaction)0.3481200.7307699169*0.3895070
F(2,39) = 0.8075 (treatments)0.0397660.2035014169*0.2415459
F(12,39) = 187.6811 (hematology parameters)0.9829787.599178169*0.3331365

Captioned Asset Tables

Many features are conserved between the mammalian nephron and planarian protonephridia.

(A) Image of a young adult C. elegans and schematic depicting the twelve pairs of sensory neurons in the anterior amphid individuals carrying a virus with k deleterious mutations at its endemic equilibrium. class carrying the fewest number of deleterious mutations is defined as mutation class k = 0. Inset: variation in the basic reproductive rate of infected individuals (gray histogram) and variation in the net reproductive rate R of infected individuals (brown histogram) resulting from variation in the number of deleterious mutations carried by circulating viruses.

https://doi.org/10.7554/eLife.16370
F(Dfn, Dfd)Partial η2Original effect size fReplication total sample sizeDetectable effect size f
F(24,39) = 0.8678 (interaction)0.3481200.7307699169*0.3895070
F(2,39) = 0.8075 (treatments)0.0397660.2035014169*0.2415459
F(12,39) = 187.6811 (hematology parameters)0.9829787.599178169*0.3331365
F(Dfn, Dfd)Partial η2Original effect size fReplication total sample sizeDetectable effect size f
F(24,39) = 0.8678 (interaction)0.3481200.7307699169*0.3895070
F(2,39) = 0.8075 (treatments)0.0397660.2035014169*0.2415459
F(12,39) = 187.6811 (hematology parameters)0.9829787.599178169*0.3331365

Captioned Asset Video

Many features are conserved between the mammalian nephron and planarian protonephridia.

(A) Image of a young adult C. elegans and schematic depicting the twelve pairs of sensory neurons in the anterior amphid individuals carrying a virus with k deleterious mutations at its endemic equilibrium. class carrying the fewest number of deleterious mutations is defined as mutation class k = 0. Inset: variation in the basic reproductive rate of infected individuals (gray histogram) and variation in the net reproductive rate R of infected individuals (brown histogram) resulting from variation in the number of deleterious mutations carried by circulating viruses.

https://doi.org/10.7554/eLife.16370

Compact Form

Compact Form Error

Please provide a valid value

Compact Form Info

You may wish to consider this

Contextual Data

  • Views 149
  • Cited 5
  • Annotations

Contextual Data With Citation

  • Views 149
  • Cited 5
  • Annotations
Cite as: eLife 2016;5:e16370 doi: 10.7554/eLife.16370

Filter Group

Subject

Inline Profile

Lorem ipsum dolor sit amet, consectetur adipiscing elit. Mauris tempor euismod mi. Morbi facilisis eros in mi consequat cursus. Nulla malesuada pretium mauris, vitae gravida diam laoreet ac. Curabitur ornare libero sed porta molestie. Ut ut sem in libero tincidunt lobortis. Nullam eros nisi, malesuada vitae leo sit amet, bibendum congue justo. Morbi iaculis lectus erat, vel dapibus metus posuere sit amet. Phasellus eget scelerisque massa. Mauris hendrerit ex in nisl ultricies elementum. Donec tellus risus, rhoncus molestie rutrum et, cursus eget mi. Praesent et elit tellus. Curabitur id sodales turpis. Fusce pulvinar aliquam commodo. Cras vitae dolor vitae metus dignissim auctor.Cras nulla purus, rhoncus et mollis in, imperdiet sed metus. In non porttitor nibh. In sit amet ipsum eget nisl laoreet tincidunt. Donec iaculis nibh quis lacus viverra sagittis. Phasellus imperdiet congue imperdiet.

Interdum et malesuada fames ac ante ipsum primis in faucibus. Nunc nisi tortor, rhoncus.

Lorem ipsum dolor sit amet, consectetur adipiscing elit. Mauris tempor euismod mi. Morbi facilisis eros in mi consequat cursus. Nulla malesuada pretium mauris, vitae gravida diam laoreet ac. Curabitur ornare libero sed porta molestie. Ut ut sem in libero tincidunt lobortis. Nullam eros nisi, malesuada vitae leo sit amet, bibendum congue justo. Morbi iaculis lectus erat, vel dapibus metus posuere sit amet. Phasellus eget scelerisque massa. Mauris hendrerit ex in nisl ultricies elementum. Donec tellus risus, rhoncus molestie rutrum et, cursus eget mi. Praesent et elit tellus. Curabitur id sodales turpis. Fusce pulvinar aliquam commodo. Cras vitae dolor vitae metus dignissim auctor.Cras nulla purus, rhoncus et mollis in, imperdiet sed metus. In non porttitor nibh. In sit amet ipsum eget nisl laoreet tincidunt. Donec iaculis nibh quis lacus viverra sagittis. Phasellus imperdiet congue imperdiet.

Interdum et malesuada fames ac ante ipsum primis in faucibus. Nunc nisi tortor, rhoncus.

Investor Logos

Lead Paras

para 1

para 2

Media Chapter Listing Item

16:50
Drosophila duet: mating flies harmonise
Flies get to grips with acoustic duetting.
This chapter is based on the following content

Meta

Research article

Mini Section

[heading]

[body]

Personalised Cover Download

You can download a poster featuring your latest paper below. It's highlighted on an imitation of an eLife journal cover.

Thank you for publishing your work with us.

  1. Download A4
  2. Download Letter

Profile Snippet

Meaningful alt text here please.
Name McNamerson
Title McTitleson
E: test.email@testemail.com

Pull Quote

Quote Incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris nisi ut reprehenderit in voluptate velit esse cillum dolore eu fugiat nulla pariatur.

Excepteur sint est laborum.

Pull Quote With Cite

Quote Incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris nisi ut reprehenderit in voluptate velit esse cillum dolore eu fugiat nulla pariatur. Excepteur sint est laborum.

May or may not be a link

Quote

Lorem ipsum dolor sit amet, consectetur adipiscing elit. Aenean interdum odio et sem fringilla, sit amet vulputate turpis sagittis. Cras non urna quam. Mauris vitae dui id ipsum varius semper. Curabitur sit amet viverra eros, ut maximus nisl. In hendrerit convallis turpis quis pulvinar. Donec porttitor faucibus ex, eget finibus velit vestibulum vitae. Donec nec nulla sollicitudin, volutpat enim interdum, sollicitudin erat.

Curabitur fermentum tellus ac rutrum efficitur. Phasellus libero magna, efficitur rutrum mauris a, mollis convallis lectus. Sed dapibus placerat eros ut vulputate. Vivamus quis sem accumsan, laoreet enim vel, dapibus ante. Nunc bibendum faucibus metus. Aliquam volutpat dapibus erat, quis ullamcorper nisl fermentum a. Praesent vulputate neque leo, vel rutrum dui auctor in. Duis eu magna et sem ullamcorper vehicula.

Quote With Cite

Lorem ipsum dolor sit amet, consectetur adipiscing elit. Aenean interdum odio et sem fringilla, sit amet vulputate turpis sagittis. Cras non urna quam. Mauris vitae dui id ipsum varius semper. Curabitur sit amet viverra eros, ut maximus nisl. In hendrerit convallis turpis quis pulvinar. Donec porttitor faucibus ex, eget finibus velit vestibulum vitae. Donec nec nulla sollicitudin, volutpat enim interdum, sollicitudin erat.

Curabitur fermentum tellus ac rutrum efficitur. Phasellus libero magna, efficitur rutrum mauris a, mollis convallis lectus. Sed dapibus placerat eros ut vulputate. Vivamus quis sem accumsan, laoreet enim vel, dapibus ante. Nunc bibendum faucibus metus. Aliquam volutpat dapibus erat, quis ullamcorper nisl fermentum a. Praesent vulputate neque leo, vel rutrum dui auctor in. Duis eu magna et sem ullamcorper vehicula.

May or may not be a link

Reference List

  1. 1
    Philosophie Anatomique
    1. Geoffroy Saint-Hilaire E.
    (1818)
    Paris: Méquignon-Marvis
  2. 2
    Understanding the rhythm of breathing: so near, yet so far
    1. JL Feldman
    2. C Del Negro
    3. PA Gray
    (2013)
    In: Julius D, Clapham DE, editors. Annual Review of Physiology 75:423–452.
    https://doi.org/10.1146/annurev-physiol-040510-130049
  3. 3
    Scripps Wired for Health Study (Registration: 000000)
    Scripps Translational Science Institute (sponsor) (2015)
  4. 4
    Boundary learning by optimization with topological constraints
    1. BV Jain
    2. B Bollman
    3. M Richardson
    4. DR Berger
    5. MN Helmstaedter
    6. KL Briggman
    7. W Denk
    8. JB Bowden
    9. JM Mendenhall
    10. WC Abraham
    11. KM Harris
    12. N Kasthuri
    13. KJ Hayworth
    14. R Schalek
    15. JC Tapia
    16. JW Lichtman
    17. HS Seung
    (2010)
    Boundary learning by optimization with topological constraints, IEEE Conference on Computer Vision and Pattern Recognition (CVPR)
  5. 5
    NKX2-5 mutations causative for congenital heart disease retain functionality and are directed to hundreds of targets
    1. R Bouveret
    2. R Bouveret
    3. N Schonrock
    4. M Ramialison
    5. T Doan
    6. D de Jong
    7. A Bondue
    8. G Kaur
    9. S Mohamed
    10. H Fonoudi
    11. C Chen
    12. M Wouters
    13. S Bhattacharya
    14. N Plachta
    15. SL Dunwoodie
    16. G Chapman
    17. C Blanpain
    18. RP Harvey
    (2015)
    NCBI Gene Expression Omnibus. Series accession number GSE44902
  6. 6
    Oldest Homo and Pliocene biogeography of the Malawi rift
    1. Schrenk F
    2. Bromage TG
    3. Betzler CG
    4. Ring U
    5. Juwayeyi YM
    (1993)
    Nature 365:833–836. PMID 8413666
    https://doi.org/10.1038/365833a0
  7. 7
    IRE-1alpha inhibitors (US20100941530)
    1. JB Patterson
    2. DG Lonergan
    3. GA Flynn
    4. Z Qingpeng
    5. PV Pallai
    (2011)
    Mankind Corp, United States patent, United States
  8. 8
    Unreliable research: Trouble at the lab
    1. The Economist
    (October 19, 2013)
    The Economist, p26–30.
  9. 9
  10. 10
    Educational Excellence Everywhere
    1. Department of Education, UK.
    (2016)
    London: HMSO
  11. 11
    The Pymol Molecular Graphics System
    1. W. L. DeLano
    (2002)
    DeLano Scientific, Palo Alto, CA
  12. 12
    Theory of large fluctuations in stochastic populations
    1. Assaf M.
    (2010)
    Hebrew University of Jerusalem
  13. 13
    The Problem of Perception
    1. Crane T
    (2005)
    The Stanford Encyclopedia of Philosophy

Section Listing

Major subject areas

  1. Biochemistry
  2. Biophysics and structural biology
  3. Cancer biology
  4. Cell biology
  5. Computational and systems biology
  6. Developmental biology and stem cells
  7. Ecology
  8. Epidemiology and global health
  9. Genes and chromosomes
  10. Genomics and evolutionary biology
  11. Human biology and medicine
  12. Immunology
  13. Microbiology and infectious disease
  14. Neuroscience
  15. Plant biology
Back to top

Section Listing Single

Magazine sections

  1. What we publish
  2. Editors & people
  3. Peer review
  4. Openness
  5. Reproducibility
  6. Incentives
Back to top

Sort Control

Statistic

320
Downloads

Login Control

Login Control Logged In

Main Menu

Pager

Pager First Page

Pager Previous Only

Select Nav

Site Header Nav Bar

Site Header Nav Bar Primary

Site Header Nav Bar Secondary Logged In

Site Header Nav Bar Secondary

View Selector

Annotation Teaser

[Do not use this base pattern directly: see the following variants of this pattern for usage]

Annotation Teaser Full

CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain
What was the Mg2+ concentration?

Annotation Teaser Highlight

Clarinet (CLA-1), a novel active zone protein required for synaptic vesicle clustering and release
Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain

Annotation Teaser Page Note

Gene free methodology for cell fate dynamics during development
What was the Mg2+ concentration?

Annotation Teaser Reply

CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
What was the Mg2+ concentration?
This is a reply.

Annotation Teaser Restricted

Molecular basis of fatty acid taste in Drosophila
Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain
What was the Mg2+ concentration?
Only me

Annotation Teaser With Image

CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain
https://images.pexels.com/photos/707837/pexels-photo-707837.jpeg?w=940&h=650&auto=compress&cs=tinysrgb

Annotation Teaser With Math

CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
<math xmlns="http://www.w3.org/1998/Math/MathML"><mlongdiv><mn> 12 </mn><mn> 16.5 </mn> <mn> 198 </mn> <msgroup position='1' shift='-1'> <msgroup> <mn> 12</mn> <msline length='2'/> </msgroup> <msgroup> <mn> 78</mn> <mn> 72</mn> <msline length='2'/> <mn> 6.0</mn> <mn> 6.0</mn> </msgroup> <msgroup position='-1'> <!-- extra shift to move to the right of the "." --> <msline length='3'/> <mn> 0</mn> </msgroup> </msgroup> </mlongdiv> </math>
Long division ftw.

Teaser

[Do not use this base pattern directly: see the following variants of this pattern for usage]

Teaser Main

  1. Cell biology
  2. Epidemiology and global health
  3. Ridiculously long name that will get truncated and narrower screen widths

Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain

Akiko Terauchi et al
Feedback signaling between the synapse and nucleus via FGF22 and IGF2 directs the activity-dependent stabilization of presynaptic terminals in the mouse hippocampus.

Teaser Main Small Image

  1. Cell biology
  2. Epidemiology and global health
Meaningful alt text here please.

Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain

Akiko Terauchi et al
Feedback signaling between the synapse and nucleus via FGF22 and IGF2 directs the activity-dependent stabilization of presynaptic terminals in the mouse hippocampus.

Teaser Main Big Image

  1. Cell biology
  2. Epidemiology and global health
Meaningful alt text here please.

Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain

Akiko Terauchi et al
Feedback signaling between the synapse and nucleus via FGF22 and IGF2 directs the activity-dependent stabilization of presynaptic terminals in the mouse hippocampus.

Teaser Secondary

Teaser Secondary Small Image

Teaser Secondary Big Image

Teaser Basic

Teaser Main Event

Teaser Secondary Event

Teaser Grid Style Labs

An image.

eLife Lens search

Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.

Teaser Grid Style Podcast

An image.

Multicellular life, potato blight and Hepatitis B

Episode 24
Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris commodo consequat.

Teaser Main With List

The eLife Sciences 2015 Annual Report

The centre of the stage at eLife in 2015 was occupied by a new human ancestor 'Homo naledi' discovered by scientists in an extraordinary find in South Africa and published in eLife in two stunning papers in September. That these scientists chose to publish such ground-breaking findings in eLife is testament both to the journal's growing significance, and to the steady cultural shift towards greater transparency and collaboration in science, which lie at the heart of eLife's mission.

Asset Viewer Inline

[Do not use this base pattern directly: see the following variants of this pattern for usage]

Asset Viewer Inline Main Figure Nojs

Meaningful alt text here please.
Many features are conserved between the mammalian nephron and planarian protonephridia.

(A) Image of a young adult C. elegans and schematic depicting the twelve pairs of sensory neurons in the anterior amphid individuals carrying a virus with k deleterious mutations at its endemic equilibrium. class carrying the fewest number of deleterious mutations is defined as mutation class k = 0. Inset: variation in the basic reproductive rate of infected individuals (gray histogram) and variation in the net reproductive rate R of infected individuals (brown histogram) resulting from variation in the number of deleterious mutations carried by circulating viruses.

https://doi.org/10.7554/eLife.14734

Asset Viewer Inline Main Figure With Supplement And Additional Assets Nojs

Figure 1 with 1 supplement see all
Meaningful alt text here please.
Many features are conserved between the mammalian nephron and planarian protonephridia.

(A) Image of a young adult C. elegans and schematic depicting the twelve pairs of sensory neurons in the anterior amphid individuals carrying a virus with k deleterious mutations at its endemic equilibrium. class carrying the fewest number of deleterious mutations is defined as mutation class k = 0. Inset: variation in the basic reproductive rate of infected individuals (gray histogram) and variation in the net reproductive rate R of infected individuals (brown histogram) resulting from variation in the number of deleterious mutations carried by circulating viruses.

https://doi.org/10.7554/eLife.14734
How should this optional heading be styled?
Table 1 - source data 1.

Is the species name mentioned in the title, impact statement, abstract and digest of eLife papers

some more details here
https://doi.org/10.7554/eLife.10181.001
Table 1 - source data 1.

Is the species name mentioned in the title, impact statement, abstract and digest of eLife papers

some more details here
https://doi.org/10.7554/eLife.10181.002

Asset Viewer Inline Main Figure With Supplement And Additional Assets

Figure 1 with 1 supplement see all
Meaningful alt text here please.
Many features are conserved between the mammalian nephron and planarian protonephridia.

(A) Image of a young adult C. elegans and schematic depicting the twelve pairs of sensory neurons in the anterior amphid individuals carrying a virus with k deleterious mutations at its endemic equilibrium. class carrying the fewest number of deleterious mutations is defined as mutation class k = 0. Inset: variation in the basic reproductive rate of infected individuals (gray histogram) and variation in the net reproductive rate R of infected individuals (brown histogram) resulting from variation in the number of deleterious mutations carried by circulating viruses.

https://doi.org/10.7554/eLife.14734
How should this optional heading be styled?
Table 1 - source data 1.

Is the species name mentioned in the title, impact statement, abstract and digest of eLife papers

some more details here
https://doi.org/10.7554/eLife.10181.001
Table 1 - source data 1.

Is the species name mentioned in the title, impact statement, abstract and digest of eLife papers

some more details here
https://doi.org/10.7554/eLife.10181.002

Asset Viewer Inline Supplementary Figure Nojs

Figure 1 supplement 1
Meaningful alt text here please.
Many features are conserved between the mammalian nephron and planarian protonephridia.

(A) Image of a young adult C. elegans and schematic depicting the twelve pairs of sensory neurons in the anterior amphid individuals carrying a virus with k deleterious mutations at its endemic equilibrium. class carrying the fewest number of deleterious mutations is defined as mutation class k = 0. Inset: variation in the basic reproductive rate of infected individuals (gray histogram) and variation in the net reproductive rate R of infected individuals (brown histogram) resulting from variation in the number of deleterious mutations carried by circulating viruses.

https://doi.org/10.7554/eLife.14734

Asset Viewer Inline Supplementary Figure With Additional Assets Nojs

Figure 1 supplement 2
Meaningful alt text here please.
Many features are conserved between the mammalian nephron and planarian protonephridia.

(A) Image of a young adult C. elegans and schematic depicting the twelve pairs of sensory neurons in the anterior amphid individuals carrying a virus with k deleterious mutations at its endemic equilibrium. class carrying the fewest number of deleterious mutations is defined as mutation class k = 0. Inset: variation in the basic reproductive rate of infected individuals (gray histogram) and variation in the net reproductive rate R of infected individuals (brown histogram) resulting from variation in the number of deleterious mutations carried by circulating viruses.

https://doi.org/10.7554/eLife.14734
How should this optional heading be styled?
Table 1 - source data 1.

Is the species name mentioned in the title, impact statement, abstract and digest of eLife papers

some more details here
https://doi.org/10.7554/eLife.10181.001
Table 1 - source data 1.

Is the species name mentioned in the title, impact statement, abstract and digest of eLife papers

some more details here
https://doi.org/10.7554/eLife.10181.002
How should this optional heading be styled?
Table 1 - source data 1.

Is the species name mentioned in the title, impact statement, abstract and digest of eLife papers

some more details here
https://doi.org/10.7554/eLife.10181.001
Table 1 - source data 1.

Is the species name mentioned in the title, impact statement, abstract and digest of eLife papers

some more details here
https://doi.org/10.7554/eLife.10181.002

Asset Viewer Inline Table Nojs

Table 1
Many features are conserved between the mammalian nephron and planarian protonephridia.

(A) Image of a young adult C. elegans and schematic depicting the twelve pairs of sensory neurons in the anterior amphid individuals carrying a virus with k deleterious mutations at its endemic equilibrium. class carrying the fewest number of deleterious mutations is defined as mutation class k = 0. Inset: variation in the basic reproductive rate of infected individuals (gray histogram) and variation in the net reproductive rate R of infected individuals (brown histogram) resulting from variation in the number of deleterious mutations carried by circulating viruses.

https://doi.org/10.7554/eLife.14734
F(Dfn, Dfd)Partial η2Original effect size fReplication total sample sizeDetectable effect size f
F(24,39) = 0.8678 (interaction)0.3481200.7307699169*0.3895070
F(2,39) = 0.8075 (treatments)0.0397660.2035014169*0.2415459
F(12,39) = 187.6811 (hematology parameters)0.9829787.599178169*0.3331365

Asset Viewer Inline Tables Nojs

Table 1
Many features are conserved between the mammalian nephron and planarian protonephridia.

(A) Image of a young adult C. elegans and schematic depicting the twelve pairs of sensory neurons in the anterior amphid individuals carrying a virus with k deleterious mutations at its endemic equilibrium. class carrying the fewest number of deleterious mutations is defined as mutation class k = 0. Inset: variation in the basic reproductive rate of infected individuals (gray histogram) and variation in the net reproductive rate R of infected individuals (brown histogram) resulting from variation in the number of deleterious mutations carried by circulating viruses.

https://doi.org/10.7554/eLife.14734
F(Dfn, Dfd)Partial η2Original effect size fReplication total sample sizeDetectable effect size f
F(24,39) = 0.8678 (interaction)0.3481200.7307699169*0.3895070
F(2,39) = 0.8075 (treatments)0.0397660.2035014169*0.2415459
F(12,39) = 187.6811 (hematology parameters)0.9829787.599178169*0.3331365
F(Dfn, Dfd)Partial η2Original effect size fReplication total sample sizeDetectable effect size f
F(24,39) = 0.8678 (interaction)0.3481200.7307699169*0.3895070
F(2,39) = 0.8075 (treatments)0.0397660.2035014169*0.2415459
F(12,39) = 187.6811 (hematology parameters)0.9829787.599178169*0.3331365

Asset Viewer Inline Video Nojs

Video 1
Many features are conserved between the mammalian nephron and planarian protonephridia.

(A) Image of a young adult C. elegans and schematic depicting the twelve pairs of sensory neurons in the anterior amphid individuals carrying a virus with k deleterious mutations at its endemic equilibrium. class carrying the fewest number of deleterious mutations is defined as mutation class k = 0. Inset: variation in the basic reproductive rate of infected individuals (gray histogram) and variation in the net reproductive rate R of infected individuals (brown histogram) resulting from variation in the number of deleterious mutations carried by circulating viruses.

https://doi.org/10.7554/eLife.14734

About Profiles

Leadership team

  1. Randy Scheckman

    Editor-in-Chief

    Lorem ipsum dolor sit amet, consectetur adipiscing elit. Mauris tempor euismod mi. Morbi facilisis eros in mi consequat cursus. Nulla malesuada pretium mauris, vitae gravida diam laoreet ac. Curabitur ornare libero sed porta molestie. Ut ut sem in libero tincidunt lobortis. Nullam eros nisi, malesuada vitae leo sit amet, bibendum congue justo. Morbi iaculis lectus erat, vel dapibus metus posuere sit amet. Phasellus eget scelerisque massa. Mauris hendrerit ex in nisl ultricies elementum. Donec tellus risus, rhoncus molestie rutrum et, cursus eget mi. Praesent et elit tellus. Curabitur id sodales turpis. Fusce pulvinar aliquam commodo. Cras vitae dolor vitae metus dignissim auctor.Cras nulla purus, rhoncus et mollis in, imperdiet sed metus. In non porttitor nibh. In sit amet ipsum eget nisl laoreet tincidunt. Donec iaculis nibh quis lacus viverra sagittis. Phasellus imperdiet congue imperdiet.

    Interdum et malesuada fames ac ante ipsum primis in faucibus. Nunc nisi tortor, rhoncus.

    Expertise
    Cell Biology
    Competing interests statement
    Donec tellus
  2. Eve Marder

    Deputy Editor

    Lorem ipsum dolor sit amet, consectetur adipiscing elit. Mauris tempor euismod mi. Morbi facilisis eros in mi consequat cursus. Nulla malesuada pretium mauris, vitae gravida diam laoreet ac. Curabitur ornare libero sed porta molestie. Ut ut sem in libero tincidunt lobortis. Nullam eros nisi, malesuada vitae leo sit amet, bibendum congue justo. Morbi iaculis lectus erat, vel dapibus metus posuere sit amet. Phasellus eget scelerisque massa. Mauris hendrerit ex in nisl ultricies elementum. Donec tellus risus, rhoncus molestie rutrum et, cursus eget mi. Praesent et elit tellus. Curabitur id sodales turpis. Fusce pulvinar aliquam commodo. Cras vitae dolor vitae metus dignissim auctor.Cras nulla purus, rhoncus et mollis in, imperdiet sed metus. In non porttitor nibh. In sit amet ipsum eget nisl laoreet tincidunt. Donec iaculis nibh quis lacus viverra sagittis. Phasellus imperdiet congue imperdiet.

    Interdum et malesuada fames ac ante ipsum primis in faucibus. Nunc nisi tortor, rhoncus.

    Expertise
    Cell Biology
    Competing interests statement
    Donec tellus

About Profiles Compact

Reviewing editors

  1. Editor name

    University of California, Los Angeles (United States)

    Research focus
    Pre-mRNA splicing
    post-transcriptional gene regulation
    Experimental organism
    Human
    Mouse
  2. Editor name

    University of California, Los Angeles (United States)

  3. Editor name

    University of California, Los Angeles (United States)

    Research focus
    Pre-mRNA splicing
    post-transcriptional gene regulation
    Experimental organism
    Human
    Mouse
  4. Editor name

    University of California, Los Angeles (United States)

    Research focus
    Pre-mRNA splicing
    post-transcriptional gene regulation
    Experimental organism
    Human
    Mouse

Additional Assets

How should this optional heading be styled?
Table 1 - source data 1.

Is the species name mentioned in the title, impact statement, abstract and digest of eLife papers (July–Sept 2014)?

some more details here
https://example.com/a-non-doi-link
Table 1 - source data 1.

Is the species name mentioned in the title, impact statement, abstract and digest of eLife papers (July–Sept 2014)?

some more details here
https://doi.org/10.7554/eLife.10181.001

Box

Box 2.

Widespread connectivity is not dependent on instrumentation and analyses.

This is an h1

This is an h2

This is an h3

This is an h4

This is an h5
This is an h6

This is a paragraph. It's a bit longer that the other things in this pattern so you can see how the wrapping works, which you can't really do unless you've got enough content. Right, that should do it. Onward!

Figure 1 with 1 supplement see all
Meaningful alt text here please.
Many features are conserved between the mammalian nephron and planarian protonephridia.

(A) Image of a young adult C. elegans and schematic depicting the twelve pairs of sensory neurons in the anterior amphid individuals carrying a virus with k deleterious mutations at its endemic equilibrium. class carrying the fewest number of deleterious mutations is defined as mutation class k = 0. Inset: variation in the basic reproductive rate of infected individuals (gray histogram) and variation in the net reproductive rate R of infected individuals (brown histogram) resulting from variation in the number of deleterious mutations carried by circulating viruses.

https://doi.org/10.7554/eLife.14734
https://doi.org/10.7554/eLife.03952.016

Decision Letter Header

eLife posts the editorial decision letter and author response on a selection of the published articles (subject to the approval of the authors). An edited version of the letter sent to the authors after peer review is shown, indicating the substantive concerns or comments; minor concerns are not usually shown. Reviewers have the opportunity to discuss the decision before the letter is sent (see review process). Similarly, the author response typically shows only responses to the major concerns raised by the reviewers.

Decision Letter Header With Profiles

  1. Meaningful alt text here please.
    Oliver Hobert
    Reviewing Editor
    Colombia University, USA
  2. Meaningful alt text here please.
    Oliver Hobert
    Reviewing Editor
    Colombia University, USA

eLife posts the editorial decision letter and author response on a selection of the published articles (subject to the approval of the authors). An edited version of the letter sent to the authors after peer review is shown, indicating the substantive concerns or comments; minor concerns are not usually shown.

Reviewers have the opportunity to discuss the decision before the letter is sent (see review process). Similarly, the author response typically shows only responses to the major concerns raised by the reviewers.

Filter Panel

Refine your results by:

Subject
Content type

Grid Listing

Grid Listing First Page

  1. An image.

    eLife Lens search

    Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
  2. An image.

    eLife Lens search

    Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
  3. An image.

    eLife Lens search

    Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
  4. An image.

    eLife Lens search

    Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
  5. An image.

    eLife Lens search

    Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
  6. An image.

    eLife Lens search

    Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
  7. An image.

    eLife Lens search

    Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
  8. An image.

    eLife Lens search

    Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
  9. An image.

    eLife Lens search

    Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.

Grid Listing Labs Teasers

  1. An image.

    eLife Lens search

    Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
  2. An image.

    eLife Lens search

    Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
  3. An image.

    eLife Lens search

    Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
  4. An image.

    eLife Lens search

    Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
  5. An image.

    eLife Lens search

    Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
  6. An image.

    eLife Lens search

    Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
  7. An image.

    eLife Lens search

    Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
  8. An image.

    eLife Lens search

    Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
  9. An image.

    eLife Lens search

    Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.

Grid Listing Pager

  1. An image.

    eLife Lens search

    Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
  2. An image.

    eLife Lens search

    Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
  3. An image.

    eLife Lens search

    Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
  4. An image.

    eLife Lens search

    Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
  5. An image.

    eLife Lens search

    Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
  6. An image.

    eLife Lens search

    Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
  7. An image.

    eLife Lens search

    Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
  8. An image.

    eLife Lens search

    Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
  9. An image.

    eLife Lens search

    Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.

Grid Listing Podcast Teasers

  1. An image.

    Multicellular life, potato blight and Hepatitis B

    Episode 24
    Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris commodo consequat.
  2. An image.

    Multicellular life, potato blight and Hepatitis B

    Episode 24
    Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris commodo consequat.
  3. An image.

    Multicellular life, potato blight and Hepatitis B

    Episode 24
    Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris commodo consequat.
  4. An image.

    Multicellular life, potato blight and Hepatitis B

    Episode 24
    Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris commodo consequat.
  5. An image.

    Multicellular life, potato blight and Hepatitis B

    Episode 24
    Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris commodo consequat.
  6. An image.

    Multicellular life, potato blight and Hepatitis B

    Episode 24
    Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris commodo consequat.
  7. An image.

    Multicellular life, potato blight and Hepatitis B

    Episode 24
    Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris commodo consequat.
  8. An image.

    Multicellular life, potato blight and Hepatitis B

    Episode 24
    Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris commodo consequat.
  9. An image.

    Multicellular life, potato blight and Hepatitis B

    Episode 24
    Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris commodo consequat.
  10. An image.

    Multicellular life, potato blight and Hepatitis B

    Episode 24
    Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris commodo consequat.
  11. An image.

    Multicellular life, potato blight and Hepatitis B

    Episode 24
    Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris commodo consequat.
  12. An image.

    Multicellular life, potato blight and Hepatitis B

    Episode 24
    Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris commodo consequat.

Listing Annotation Teasers

Annotations

  1. CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
    Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain
    What was the Mg2+ concentration?
  2. Clarinet (CLA-1), a novel active zone protein required for synaptic vesicle clustering and release
    Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain
  3. Gene free methodology for cell fate dynamics during development
    What was the Mg2+ concentration?
  4. CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
    What was the Mg2+ concentration?
    This is a reply.
  5. Molecular basis of fatty acid taste in Drosophila
    Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain
    What was the Mg2+ concentration?
    Only me
  6. CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
    Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain
    https://images.pexels.com/photos/707837/pexels-photo-707837.jpeg?w=940&h=650&auto=compress&cs=tinysrgb
  7. CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
    <math xmlns="http://www.w3.org/1998/Math/MathML"><mlongdiv><mn> 12 </mn><mn> 16.5 </mn> <mn> 198 </mn> <msgroup position='1' shift='-1'> <msgroup> <mn> 12</mn> <msline length='2'/> </msgroup> <msgroup> <mn> 78</mn> <mn> 72</mn> <msline length='2'/> <mn> 6.0</mn> <mn> 6.0</mn> </msgroup> <msgroup position='-1'> <!-- extra shift to move to the right of the "." --> <msline length='3'/> <mn> 0</mn> </msgroup> </msgroup> </mlongdiv> </math>
    Long division ftw.
  8. CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
    Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain
    https://www.youtube.com/watch?v=oHg5SJYRHA0

Listing Annotation Teasers First Page

Annotations

  1. CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
    Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain
    What was the Mg2+ concentration?
  2. Clarinet (CLA-1), a novel active zone protein required for synaptic vesicle clustering and release
    Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain
  3. Gene free methodology for cell fate dynamics during development
    What was the Mg2+ concentration?
  4. CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
    What was the Mg2+ concentration?
    This is a reply.
  5. Molecular basis of fatty acid taste in Drosophila
    Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain
    What was the Mg2+ concentration?
    Only me
  6. CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
    Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain
    https://images.pexels.com/photos/707837/pexels-photo-707837.jpeg?w=940&h=650&auto=compress&cs=tinysrgb
  7. CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
    <math xmlns="http://www.w3.org/1998/Math/MathML"><mlongdiv><mn> 12 </mn><mn> 16.5 </mn> <mn> 198 </mn> <msgroup position='1' shift='-1'> <msgroup> <mn> 12</mn> <msline length='2'/> </msgroup> <msgroup> <mn> 78</mn> <mn> 72</mn> <msline length='2'/> <mn> 6.0</mn> <mn> 6.0</mn> </msgroup> <msgroup position='-1'> <!-- extra shift to move to the right of the "." --> <msline length='3'/> <mn> 0</mn> </msgroup> </msgroup> </mlongdiv> </math>
    Long division ftw.
  8. CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
    Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain
    https://www.youtube.com/watch?v=oHg5SJYRHA0

Listing Annotation Teasers Pager

Annotations

  1. CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
    Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain
    What was the Mg2+ concentration?
  2. Clarinet (CLA-1), a novel active zone protein required for synaptic vesicle clustering and release
    Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain
  3. Gene free methodology for cell fate dynamics during development
    What was the Mg2+ concentration?
  4. CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
    What was the Mg2+ concentration?
    This is a reply.
  5. Molecular basis of fatty acid taste in Drosophila
    Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain
    What was the Mg2+ concentration?
    Only me
  6. CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
    Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain
    https://images.pexels.com/photos/707837/pexels-photo-707837.jpeg?w=940&h=650&auto=compress&cs=tinysrgb
  7. CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
    <math xmlns="http://www.w3.org/1998/Math/MathML"><mlongdiv><mn> 12 </mn><mn> 16.5 </mn> <mn> 198 </mn> <msgroup position='1' shift='-1'> <msgroup> <mn> 12</mn> <msline length='2'/> </msgroup> <msgroup> <mn> 78</mn> <mn> 72</mn> <msline length='2'/> <mn> 6.0</mn> <mn> 6.0</mn> </msgroup> <msgroup position='-1'> <!-- extra shift to move to the right of the "." --> <msline length='3'/> <mn> 0</mn> </msgroup> </msgroup> </mlongdiv> </math>
    Long division ftw.
  8. CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
    Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain
    https://www.youtube.com/watch?v=oHg5SJYRHA0

Listing Profile Snippets

Listing of profile snippets

  1. Meaningful alt text here please.
    Prabhat Jha
    University of Toronto
  2. Meaningful alt text here please.
    Richard Losick
    Harvard University
  3. See more things!

Listing Read More

Further reading

    1. Cell Biology
    2. Epidemiology and global health
    Lee R Berger
    Research article

    Optimal decision-making requires balancing fast but error-prone and more accurate but slower decisions through adjustments of decision thresholds. Here, we demonstrate two distinct correlates of such speed-accuracy adjustments by recording subthalamic nucleus (STN) activity and electroencephalography in 11 Parkinson’s disease patients during a perceptual decision-making task; STN low-frequency oscillatory (LFO) activity (2–8 Hz), coupled to activity at prefrontal electrode Fz, and STN beta activity (13–30 Hz) coupled to electrodes C3/C4 close to motor cortex. These two correlates differed not only in their cortical topography and spectral characteristics but also in the relative timing of recruitment and in their precise relationship with decision thresholds. Increases of STN LFO power preceding the response predicted increased thresholds only after accuracy instructions, while cue-induced reductions of STN beta power decreased thresholds irrespective of instructions. These findings indicate that distinct neural mechanisms determine whether a decision will be made in haste or with caution.

    1. Cell Biology
    2. Epidemiology and global health
    Lee R Berger
    Research article

    Optimal decision-making requires balancing fast but error-prone and more accurate but slower decisions through adjustments of decision thresholds.

Listing Read More First Page

Further reading

    1. Cell Biology
    2. Epidemiology and global health
    Lee R Berger
    Research article

    Optimal decision-making requires balancing fast but error-prone and more accurate but slower decisions through adjustments of decision thresholds. Here, we demonstrate two distinct correlates of such speed-accuracy adjustments by recording subthalamic nucleus (STN) activity and electroencephalography in 11 Parkinson’s disease patients during a perceptual decision-making task; STN low-frequency oscillatory (LFO) activity (2–8 Hz), coupled to activity at prefrontal electrode Fz, and STN beta activity (13–30 Hz) coupled to electrodes C3/C4 close to motor cortex. These two correlates differed not only in their cortical topography and spectral characteristics but also in the relative timing of recruitment and in their precise relationship with decision thresholds. Increases of STN LFO power preceding the response predicted increased thresholds only after accuracy instructions, while cue-induced reductions of STN beta power decreased thresholds irrespective of instructions. These findings indicate that distinct neural mechanisms determine whether a decision will be made in haste or with caution.

    1. Cell Biology
    2. Epidemiology and global health
    Lee R Berger
    Research article

    Optimal decision-making requires balancing fast but error-prone and more accurate but slower decisions through adjustments of decision thresholds.

Listing Teasers

Listing of teasers

    1. Microbiology and Infectious Disease
    Meaningful alt text please.

    Quorum sensing control of Type VI secretion factors restricts the proliferation of quorum-sensing mutants

    Charlotte Majerczyk et al.
    Quorum-sensing control of Burkholderia thailandensis toxin and immunity pairs serves to police quorum-sensing mutants and may represent a general strategy whereby cooperators can police mutants.
  1. Mapping global environmental suitability for Zika virus

    Jane P Messina et al
  2. Meaningful alt text please.

    The global antigenic diversity of swine influenza A viruses

    Nicola S Lewis et al.
    Swine populations worldwide are sporadically infected by influenza viruses from humans and birds leading to geographically heterogeneous swine influenza virus populations that pose epizootic and pandemic threats.

Listing Teasers First Page

Listing of teasers

    1. Microbiology and Infectious Disease
    Meaningful alt text please.

    Quorum sensing control of Type VI secretion factors restricts the proliferation of quorum-sensing mutants

    Charlotte Majerczyk et al.
    Quorum-sensing control of Burkholderia thailandensis toxin and immunity pairs serves to police quorum-sensing mutants and may represent a general strategy whereby cooperators can police mutants.
  1. Mapping global environmental suitability for Zika virus

    Jane P Messina et al
  2. Meaningful alt text please.

    The global antigenic diversity of swine influenza A viruses

    Nicola S Lewis et al.
    Swine populations worldwide are sporadically infected by influenza viruses from humans and birds leading to geographically heterogeneous swine influenza virus populations that pose epizootic and pandemic threats.

Listing Teasers Highlights

Highlights controls:

Listing Teasers Pager

Listing of teasers

    1. Microbiology and Infectious Disease
    Meaningful alt text please.

    Quorum sensing control of Type VI secretion factors restricts the proliferation of quorum-sensing mutants

    Charlotte Majerczyk et al.
    Quorum-sensing control of Burkholderia thailandensis toxin and immunity pairs serves to police quorum-sensing mutants and may represent a general strategy whereby cooperators can police mutants.
  1. Mapping global environmental suitability for Zika virus

    Jane P Messina et al
  2. Meaningful alt text please.

    The global antigenic diversity of swine influenza A viruses

    Nicola S Lewis et al.
    Swine populations worldwide are sporadically infected by influenza viruses from humans and birds leading to geographically heterogeneous swine influenza virus populations that pose epizootic and pandemic threats.

Read More Item

    1. Cell Biology
    2. Epidemiology and global health
    Lee R Berger
    Research article

    Optimal decision-making requires balancing fast but error-prone and more accurate but slower decisions through adjustments of decision thresholds. Here, we demonstrate two distinct correlates of such speed-accuracy adjustments by recording subthalamic nucleus (STN) activity and electroencephalography in 11 Parkinson’s disease patients during a perceptual decision-making task; STN low-frequency oscillatory (LFO) activity (2–8 Hz), coupled to activity at prefrontal electrode Fz, and STN beta activity (13–30 Hz) coupled to electrodes C3/C4 close to motor cortex. These two correlates differed not only in their cortical topography and spectral characteristics but also in the relative timing of recruitment and in their precise relationship with decision thresholds. Increases of STN LFO power preceding the response predicted increased thresholds only after accuracy instructions, while cue-induced reductions of STN beta power decreased thresholds irrespective of instructions. These findings indicate that distinct neural mechanisms determine whether a decision will be made in haste or with caution.

  • Statistic Collection

    • 54,741
      Views
    • 320
      Downloads
    • 89
      Citations

    Content Header Profile

    Kananinoheaokuuhomeopuukaimanaalohilo

    • University of West of Nowhere
    • University of Middle of Nowhere
    • University of East of Nowhere