Altmetric

Altmetric Small

Altmetric provides a collated score for online attention across various platforms and media.
See more details

Author Details

[Do not use this base pattern directly: see the following variants of this pattern for usage]

Author Details Group

ICGC Chronic Myeloid Disorders Group

  1. Cancer Genome Project, Wellcome Trust Sanger Institute, Hinxton, United Kingdom
Competing interests
No competing interests declared
  1. Luca Malcovati, Fondazione IRCCS Policlinico San Matteo, University of Pavia, Pavia, Italy
  2. Sudhir Tauro, Division of Medial Sciences, University of Dundee, Dundee, UK
  3. Jacqueline Boultwood, Nuffield Department of Clinical Laboratory Sciences, University of Oxford, UK

Author Details Person

Jenny Bloggs

  1. Evolutionary Studies Institute and Centre of Excellence in PalaeoSciences, University of the Witwatersrand, Johannesburg, South Africa
  2. School of Geosciences, University of the Witwatersrand, Johannesburg, South Africa
Present addresses
  1. Department of Inventive Inventions, Univertity of Wessex, Windowchester, Wessex
  2. Department of Underwater Basket Weaving, University of Somewhere
Contribution
Conception and design, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article, Contributed unpublished essential data or reagents
Contributed equally with
  1. Francesca Smith
  2. Wendel Jakes III
For correspondence
  1. jenny@bloggs.com
  2. +1 555-4321-09876
Competing interests
No competing interests declared
ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-3400-7927

Author Details Sub Group

ICGC Chronic Myeloid Disorders Group

  1. Cancer Genome Project, Wellcome Trust Sanger Institute, Hinxton, United Kingdom
Competing interests
No competing interests declared
Sub-group 1
  1. Luca Malcovati, Fondazione IRCCS Policlinico San Matteo, University of Pavia, Pavia, Italy
  2. Sudhir Tauro, Division of Medial Sciences, University of Dundee, Dundee, UK
Sub-group 2
  1. Jacqueline Boultwood, Nuffield Department of Clinical Laboratory Sciences, University of Oxford, UK

Breadcrumb

Breadcrumb With Url

Breadcrumb Without Url

Button

Button Action Citation

Button Action Comment With Hypothesis

Button Action Comment

Button Action Download

Button Action Share

Button Action

Button Clipboard

Button Extra Small

Button Full

Button Inactive

Button Login

Button Outline

Button Reversed Extra Small

Button Reversed Inactive

Button Reversed Small

Button Reversed

Button Secondary

Button Small

Caption Text

[Do not use this base pattern directly: see the following variants of this pattern for usage]

Caption Text Additional Asset

Table 1 - source data 1.

Is the species name mentioned in the title, impact statement, abstract and digest of eLife papers (July–Sept 2014)?

some more details here

Caption Text Captioned Asset

Many features are conserved between the mammalian nephron and planarian protonephridia.

(A) Image of a young adult C. elegans and schematic depicting the twelve pairs of sensory neurons in the anterior amphid individuals carrying a virus with k deleterious mutations at its endemic equilibrium. class carrying the fewest number of deleterious mutations is defined as mutation class k = 0. Inset: variation in the basic reproductive rate of infected individuals (gray histogram) and variation in the net reproductive rate R of infected individuals (brown histogram) resulting from variation in the number of deleterious mutations carried by circulating viruses.

Listed are, for each triplet of cell types, the probabilities of the four topologies for prior odds p(βi=1)p(βi=0)=0.05; the number of topologies that reach probability p(T | {giA,B,C})>0.6 for some value of p(βi=1)p(βi=0) between 10−6 and 102; the non-null topology that has the highest probability p(T | {giA,B,C}) over the range of prior odds (if the null topology is the most likely topology for the entire range of prior odds, the topology is marked ‘null’); and the value of highest probability p(T | {giA,B,C}) over the range of prior odds; the correct topology and triplet length in the traditional model; and the correct topology and triplet length in the Adolfsson model.

(A) Doxycycline-inducible gam-gfp fusion construct in the E. coli chromosome. Constitutively produced TetR protein represses the PN25tetO promoter, which produces GamGFP upon doxycycline induction. oriC, origin of replication; ter, replication terminus; arrows, directions of transcription. (B) Phage λ assay for end-blocking activity by Mu Gam and GamGFP. Rolling-circle replication of phage λred gam is inhibited by E. coli RecBCD, which causes small plaques of λred gam on wild-type E. coli (Smith, 1983). Mu Gam protein binds and protects DNA ends from RecBCD exonuclease activity (Akroyd and Symonds, 1986) and so is expected to allow rolling-circle replication of λred gam and therefore allow formation of large plaques. (C) λred gam plaques are small on recB+ (WT) and large on recB-deficient cells (recB-). Plaques produced on WT cells carrying gam and gam-gfp are small when Gam and GamGFP proteins are not produced (Uninduced). (D) λred gam produce large plaques on WT cells if Gam or GamGFP are produced (Induced). (E) UV sensitivity of E. coli recB-null mutant compared with recB+(WT), and uninduced gam and gam-gfp carrying cells. WT (), recB− (), WT GamGFP, (); WT Gam, (). (F) Induction of Gam or GamGFP with 200 ng/ml doxycycline causes UV sensitivity similar to that of recB-null mutant cells, indicating that Gam or GamGFP block RecBCD action on double-stranded DNA ends. WT, SMR14327; recB, SMR8350; WT GamGFP, SMR14334; WT Gam, SMR14333. Representative experiment performed three times with comparable results.

Code

<dock_design>
  <SCOREFXNS>
    <fullatom weights=beta symmetric = 0> </fullatom> 
  </SCOREFXNS> 
  <!-- Longabadaliasametatquedoloreaqueesthicillabadaliasametatquedoloreaqueesthicillabadaliasametatquedoloreaqueesthicillolong --> 
  <FILTERS> 
    <Ddg name=ddg scorefxn=fullatom threshold = 0 jump = 1 repeats = 1 repack = 1 confidence = 1/>
    <Sasa name=sasa confidence = 0/>
    <ShapeComplementarity name=shape verbose = 1 confidence = 0 jump = 1/> 
  </FILTERS>
  <MOVERS>
    <AtomTree name=docking_tree docking_ft = 1/>
    <DockSetupMover name=setup_dock/>
    <DockingProtocol name=dock docking_score_high=fullatom low_res_protocol_only = 0 docking_local_refine = 0 dock_min = 1 />
  </MOVERS>
  <APPLY_TO_POSE>
  </APPLY_TO_POSE> 
  <PROTOCOLS> 
    <Add mover_name=docking_tree/> 
    <Add mover_name=setup_dock/> 
    <Add mover_name=dock/> 
    <Add filter_name=ddg/> 
    <Add filter_name=sasa/> 
    <Add filter_name=shape/> 
  </PROTOCOLS> 
</dock_design>

Date

Date Expanded

Date Updated

Updated

Definition List

Research focus
Pre-mRNA splicing
post-transcriptional gene regulation
Experimental organism
Human
Mouse

Definition List Inline

Research focus
Pre-mRNA splicing
post-transcriptional gene regulation
Experimental organism
Human
Mouse

Definition List Timeline With Version

Version of Record
Read the peer reviews
Reviewed Preprint
v3
Reviewed Preprint
v2
Reviewed Preprint
v1

Definition List Timeline Without Version

Version of Record
Accepted Manuscript

Doi

https://doi.org/10.7554/eLife.16370

Doi Article Section

https://doi.org/10.7554/eLife.16370

Doi Asset

https://doi.org/10.7554/eLife.16370

Doi Truncated

doi: 10.7554/eLife.16370

Iframe

Iframe Figshare

Iframe Google Map

Iframe With Title

Info Bar

You may want to consider this

Info Bar Announcement

Very important announcement

Info Bar Attention

Please complete the following tasks

Info Bar Correction Notice

This is a correction notice; read the corrected article Article

Info Bar Dismissible

Read the call for papers for the eLife Special Issue on aging, Geroscience and Longevity.

Info Bar Multiple Versions

Read the most recent version of this article

Info Bar Success

Operation completed successfully

Info Bar Warning

Watch out for the thing

List Heading

Podcasts

List

  • item 1
  • item 2

List Bullet

  • item 1
  • item 2

List Line

  • Version of Record published
  • Accepted Manuscript published
  • Accepted
  • Received
  • Preprint posted

List Numbers

  1. item 1
  2. item 2

List Roman

  1. item 1
  2. item 2

List Teaser

Math

Body Mass=0.060×FSTpr+13.856,SEE=6.78,r=0.50,p=<0.001.

Math Long

(7) y=β0+β1Choice+β2SVspend+β3SVsave+β4SeqSV+β5SeqLength+β6Cueposition+β7Left/right+β8Sequenceprogress+ϵ,

Math With Label

(10) SVsaven= 1m−n∑i=n+1mSVspendi,

Media Source

Message Bar

1824 results found

Modal Window

Modal Window Citations

Modal Window Share

Nav Linked Item

Orcid

ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-3400-7927

Paragraph

Some text in a paragraph element

Picture

Meaningful alt text here please.

Picture Svg With Fallback

Meaningful alt text here please.

Previous Version Warning

A newer version is available. Read the latest version.

Process Block

Version of Record: This is the final version of the article.

Process Block New Process

Version of Record: This is the final version of the article.

Read more about eLife's peer review process.

Social Media Sharers Journal

Social Media Sharers Journal Comment

Social Media Sharers

Speech Bubble

Speech Bubble Has Placeholder

Speech Bubble Share Your Feedback

Speech Bubble Small Is Loading

Speech Bubble Small

Speech Bubble Wrapped Has Placeholder

Table

F(Dfn, Dfd)F(Dfn, Dfd)F(Dfn, Dfd)F(Dfn, Dfd)F(Dfn, Dfd)F(Dfn, Dfd)F(Dfn, Dfd)F(Dfn, Dfd)F(Dfn, Dfd)Partial η2Original effect size fReplication total sample sizeDetectable effect size f
F(24,39) = 0.8678 (interaction)0.3481200.7307699169*0.3895070
F(2,39) = 0.8075 (treatments)0.0397660.20350141690.2415459
F(12,39) = 187.6811 (hematology parameters)0.9829787.599178169*0.3331365
F(Dfn, Dfd)F(Dfn, Dfd)F(Dfn, Dfd)F(Dfn, Dfd)F(Dfn, Dfd)F(Dfn, Dfd)F(Dfn, Dfd)F(Dfn, Dfd)F(Dfn, Dfd)Partial η2Original effect size fReplication total sample sizeDetectable effect size f
F(24,39) = 0.8678 (interaction)0.3481200.7307699169*0.3895070
F(2,39) = 0.8075 (treatments)0.0397660.2035014169*0.2415459
F(12,39) = 187.6811 (hematology parameters)0.9829787.599178169*0.3331365
  1. *

    Footnote 1.

  2. The values in parenthesis refer to the highest resolution shell.

    *Rmerge=∑hkl∑i|I(hkl;i)−<I(hkl)>|∑hkl∑i(hkl;i) where I(hkl;i) is the intensity of an individual measurement of a reflection and <I(hkl)> is the average intensity of that reflection.

Table Code Blocks

data = {{x1,R1},{x2,R2},{x3,R3}...,{xm,Rm}};
loglog=Function[{x,y},{Log[x/[C⁢a2+]0],Log[y]}];
datalog=Apply[loglog,data,{1}];


peakr = Function[{A,B,C,x},Piecewise[{{A+(1/2)*Log[1-(2/3)*B⁢x]
+C*(1-(1-(2/3)*B⁢x)^(3/2),x<3/2/B,Infinity}}]];


fit = NonlinearModelFit[datalog,{peakr[A,B,C,x],{A>0,B>0,C>0}},
{{A,A0},{B,B0},{C,C0}},x,Method->NMinimize];
fit['ParameterTable']
  1. Table with Code Blocks

Table Equations

Definitions of the simulated system
TypeStatus
Protein assembly occupancyk∈[1,Np]Pk∈{unbound,bound}
Histonesi∈[1,N]Si∈{me0,me1,me2,me3}
Regions of histonesRm={Histones[1,...,NNR]whenm=NR(nucleationregion)Histones[NNR+1,...,N]whenm=B(bodyregion),NB=N−NNRHistones[1,...,N]whenm=L(entireregion),NL=N
  1. Table with Equations

Table Gene Sequences

Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Recombinant DNA reagentsynthesized gene - mScarletIGenscriptactagtggtggttcaggaGTTTCAAAAGGTGAAGCCGTTATTAAAGAATTTATGAGATTCAAGGTTCACATGGAAGGAAGTATGAACGGTCATGAATTTGAGATTGAAGGAGAAGGTGAAGGTAGACCATATGAAGGCACCCAAACAGCTAAATTAAAAGTAACTAAAGGTGGTCCATTACCATTTAGTTGGGATATTTTATCTCCACAATTTATGTATGGTTCACGTGCTTTCAttAAACATCCAGCAGATATTCCAGATTATTATAAACAATCATTTCCAGAAGGTTTTAAATGGGAACGTGTCATGAACTTTGAAGATGGTGGAGCAGTTACAGTCACACAAGATACCTCATTAGAAGATGGTACATTAATATATAAAGTTAAATTACGTGGTACTAATTTTCCACCAGACGGTCCAGTAATGCAAAAAAAAACAATGGGCTGGGAAGCTAGTACAGAACGTTTATATCCTGAAGATGGTGTCCTTAAAGGCGATATAAAAATGGCCTTGAGATTAAAGGATGGTGGTAGGTATTTAGCAGATTTCAAAACCACTTATAAAGCAAAAAAACCAGTTCAAATGCCAGGTGCATATAATGTTGATAGAAAACTTGATATTACCAGTCATAATGAAGATTACACAGTTGTCGAACAATACGAACGTTCTGAAGGTCGTCATAGCACTGGTGGTATGGATGAATTATACAAATAAgctagcd
Recombinant DNA reagentsynthesized gene - mNeonGenscriptactagtggtggttcaggaGTTTCAAAAGGTGAAGCCGTTATTAAAGAATTTATGAGATTCAAGGTTCACATGGAAGGAAGTATGAACGGTCATGAATTTGAGATTGAAGGAGAAGGTGAAGGTAGACCATATGAAGGCACCCAAACAGCTAAATTAAAAGTAACTAAAGGTGGTCCATTACCATTTAGTTGGGATATTTTATCTCCACAATTTATGTATGGTTCACGTGCTTTCAttAAACATCCAGCAGATATTCCAGATTATTATAAACAATCATTTCCAGAAGGTTTTAAATGGGAACGTGTCATGAACTTTGAAGATGGTGGAGCAGTTACAGTCACACAAGATACCTCATTAGAAGATGGTACATTAATATATAAAGTTAAATTACGTGGTACTAATTTTCCACCAGACGGTCCAGTAATGCAAAAAAAAACAATGGGCTGGGAAGCTAGTACAGAACGTTTATATCCTGAAGATGGTGTCCTTAAAGGCGATATAAAAATGGCCTTGAGATTAAAGGATGGTGGTAGGTATTTAGCAGATTTCAAAACCACTTATAAAGCAAAAAAACCAGTTCAAATGCCAGGTGCATATAATGTTGATAGAAAACTTGATATTACCAGTCATAATGAAGATTACACAGTTGTCGAACAATACGAACGTTCTGAAGGTCGTCATAGCACTGGTGGTATGGATGAATTATACAAATAAgctagc
  1. Table with Gene Sequences

Table Inline Images

unwindingturnover
#Chemical drawingIC50[95%CI];µMIC50[95%CI];µM
22.2
[1.7–2.7]
3.2
[2.3–4.0]
  1. Table with inline images

Table Long Url

Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Software, algorithmMetamorphMetamorph vhttps://www.moleculardevices.com/products/cellular-imaging-systems/acquisition-and-analysis-software/metamorph-microscopy#gref
  1. Table with long url

Table Ordered List

Factors classically associated with immune functions
ProteinImmune system propertiesNervous system propertiesReferences
Antimicrobial peptides(AMPs)
  1. Secreted by epithelial and phagocytic cells

  2. Disrupt microbial membranes leading to destruction of pathogen

  1. Antimicrobial in nervous system niches

  2. Control chemotaxis of immune cells and astroglia

  3. Mediate iron homeostasis

  4. Modulate nerve impulses

  5. Implicated in aging and neurodegeneration

Hanson et al., 2019;Lezi et al., 2018;Su et al., 2010;Zasloff, 2002
  1. Table with ordered list

Table Unordered List

Factors classically associated with immune functions
ProteinImmune system propertiesNervous system propertiesReferences
Antimicrobial peptides(AMPs)
  • Secreted by epithelial and phagocyticcells

  • Disrupt microbial membranes leading to destruction of pathogen

  • Antimicrobial in nervous system niches

  • Control chemotaxis of immune cells and astroglia

  • Mediate iron homeostasis

  • Modulate nerve impulses

  • Implicated in aging and neurodegeneration

Hanson et al., 2019;Lezi et al., 2018;Su et al., 2010;Zasloff, 2002
  1. Table with unordered list

Term

Important

Term Highlighted

Important

Tweet

Tweet With Cards

Tweet With Conversation

Video

Client Error

Say what?

Your browser sent us something unexpected.
We’ve logged the problem and will look into it.

Not Found

Oops!

The page you were looking for is not found.

Not Found Button

Oops!

The page you were looking for is not found.

Back to home

Orcid Error Visibility Setting

Your ORCID iD settings prevented log in

Please update the visibility settings of the name associated with your ORCID iD before trying again.

Step 1: Open your name's visibility settings on your ORCID iD page

Go to orcid.org/my-orcid to change the visibility settings of your name by using the pencil icon.

It should be in the top left corner of your ORCID iD page, next to your name.

Change the visibility settings of your name by using the pencil icon.

Step 2: Change the visibility setting

Change the visibility setting to "everyone" or "trusted parties" and save your changes. Locking your name will not allow you to log in to eLife.

You may be asked to authorise eLife as a trusted party when you try to log in again. Learn more about ORCID visibility settings.

Change the visibility setting to everyone or trusted parties and save your changes.

Step 3: Return to eLife and log in again

Return to elifesciences.org and attempt to log in again. If you are still unable to log in please contact us.

Attempt to log in again.

Server Error

Kabooooooom!

Something has gone seriously wrong.
We’ve logged the problem and will look into it.

Service Unavailable

Back soon

We’re carrying out planned maintenance on this page.

Checkbox

item one
item two

Checkboxes

Checkboxes
  • Children detected!

Checkboxes Disabled

Checkboxes
  • Children detected!

Checkboxes Error

Checkboxes
  • Children detected!
Please provide a valid value

Checkboxes Info Error

Checkboxes
  • Children detected!
You may wish to consider this
Please provide a valid value

Checkboxes Info

Checkboxes
  • Children detected!
You may wish to consider this

Hidden Field

Honeypot

Select

Select Error

Please provide a valid value

Select Info Error

You may wish to consider this
Please provide a valid value

Select Info

You may wish to consider this

Text Area

Text Area Error

Please provide a valid value

Text Area Info Error

You may wish to consider this
Please provide a valid value

Text Area Info

You may wish to consider this

Text Field

Text Field Error

Please provide a valid value

Text Field Hidden Until Checked With Checkbox Id

Text Field Hidden Until Checked With Value

Text Field Hidden Until Checked

Text Field Info Error

You may wish to consider this
Please provide a valid value

Text Field Info

You may wish to consider this

Reference

[Do not use this base pattern directly: see the following variants of this pattern for usage]

Reference Book Chapter

Book
  1. Feldman JL
  2. Del Negro C
  3. Gray PA
(2013) Understanding the rhythm of breathing: so near, yet so far
In: Julius D, Clapham DE, editors. Annual Review of Physiology 75:423–452.
https://doi.org/10.1146/annurev-physiol-040510-130049

Reference Book

Book
  1. Geoffroy Saint-Hilaire E.
(1818)
Philosophie Anatomique
Paris: Méquignon-Marvis

Reference Clinical Trial

Clinical Trial
Scripps Wired for Health Study (Registration: 000000)
Scripps Translational Science Institute (sponsor) (2015)

Reference Conference With Doi

Conference
  1. Jain BV
  2. Bollman B
  3. Richardson M
  4. Berger DR
  5. Helmstaedter MN
  6. Briggman KL
  7. Denk W
  8. Bowden JB
  9. Mendenhall JM
  10. Abraham WC
  11. Harris KM
  12. Kasthuri N
  13. Hayworth KJ
  14. Schalek R
  15. Tapia JC
  16. Lichtman JW
  17. Seung HS
(2010) Boundary learning by optimization with topological constraints
Boundary learning by optimization with topological constraints, IEEE Conference on Computer Vision and Pattern Recognition (CVPR)
https://doi.org/10.1038/365833a0

Reference Conference

Conference
  1. Jain BV
  2. Bollman B
  3. Richardson M
  4. Berger DR
  5. Helmstaedter MN
  6. Briggman KL
  7. Denk W
  8. Bowden JB
  9. Mendenhall JM
  10. Abraham WC
  11. Harris KM
  12. Kasthuri N
  13. Hayworth KJ
  14. Schalek R
  15. Tapia JC
  16. Lichtman JW
  17. Seung HS
(2010)
Boundary learning by optimization with topological constraints
Boundary learning by optimization with topological constraints, IEEE Conference on Computer Vision and Pattern Recognition (CVPR)

Reference Data With Doi

Data
  1. Bouveret R
  2. Bouveret R
  3. Schonrock N
  4. Ramialison M
  5. Doan T
  6. de Jong D
  7. Bondue A
  8. Kaur G
  9. Mohamed S
  10. Fonoudi H
  11. Chen C
  12. Wouters M
  13. Bhattacharya S
  14. Plachta N
  15. Dunwoodie SL
  16. Chapman G
  17. Blanpain C
  18. Harvey RP
(2015) NKX2-5 mutations causative for congenital heart disease retain functionality and are directed to hundreds of targets
NCBI Gene Expression Omnibus.
https://doi.org/10.1038/365833a0

Reference Data

Data
  1. Bouveret R
  2. Bouveret R
  3. Schonrock N
  4. Ramialison M
  5. Doan T
  6. de Jong D
  7. Bondue A
  8. Kaur G
  9. Mohamed S
  10. Fonoudi H
  11. Chen C
  12. Wouters M
  13. Bhattacharya S
  14. Plachta N
  15. Dunwoodie SL
  16. Chapman G
  17. Blanpain C
  18. Harvey RP
(2015)
NKX2-5 mutations causative for congenital heart disease retain functionality and are directed to hundreds of targets
NCBI Gene Expression Omnibus. Series accession number GSE44902

Reference Journal Article With Doi Without Link

  1. Schrenk F
  2. Bromage TG
  3. Betzler CG
  4. Ring U
  5. Juwayeyi YM
  6. Schrenk F
  7. Bromage TG
  8. Betzler CG
  9. Ring U
  10. Juwayeyi YM
  11. Schrenk F
  12. Bromage TG
  13. Betzler CG
  14. Ring U
  15. Juwayeyi YM
  16. Schrenk F
  17. Bromage TG
  18. Betzler CG
  19. Ring U
  20. Juwayeyi YM
  21. Schrenk F
  22. Bromage TG
  23. Betzler CG
  24. Ring U
  25. Juwayeyi YM
(1993)
Oldest Homo and Pliocene biogeography of the Malawi rift
Nature 365:833–836.
https://doi.org/10.1038/365833a0

Reference Journal Article With Doi

  1. Schrenk F
  2. Bromage TG
  3. Betzler CG
  4. Ring U
  5. Juwayeyi YM
  6. Schrenk F
  7. Bromage TG
  8. Betzler CG
  9. Ring U
  10. Juwayeyi YM
  11. Schrenk F
  12. Bromage TG
  13. Betzler CG
  14. Ring U
  15. Juwayeyi YM
  16. Schrenk F
  17. Bromage TG
  18. Betzler CG
  19. Ring U
  20. Juwayeyi YM
  21. Schrenk F
  22. Bromage TG
  23. Betzler CG
  24. Ring U
  25. Juwayeyi YM
(1993) Oldest Homo and Pliocene biogeography of the Malawi rift
Nature 365:833–836.
https://doi.org/10.1038/365833a0

Reference Journal Article With Link

  1. Schrenk F
  2. Bromage TG
  3. Betzler CG
  4. Ring U
  5. Juwayeyi YM
  6. Schrenk F
  7. Bromage TG
  8. Betzler CG
  9. Ring U
  10. Juwayeyi YM
  11. Schrenk F
  12. Bromage TG
  13. Betzler CG
  14. Ring U
  15. Juwayeyi YM
  16. Schrenk F
  17. Bromage TG
  18. Betzler CG
  19. Ring U
  20. Juwayeyi YM
  21. Schrenk F
  22. Bromage TG
  23. Betzler CG
  24. Ring U
  25. Juwayeyi YM
(1993) Oldest Homo and Pliocene biogeography of the Malawi rift
Nature 365:833–836.

Reference Patent

Patent
  1. Patterson JB
  2. Lonergan DG
  3. Flynn GA
  4. Qingpeng Z
  5. Pallai PV
(2011)
IRE-1alpha inhibitors (US20100941530)
Mankind Corp, United States patent, United States

Reference Periodical

Reference Preprint With Doi

Reference Report

Reference Software

Software
  1. DeLano W. L.
(2002)
The Pymol Molecular Graphics System
DeLano Scientific, Palo Alto, CA

Reference Thesis

Reference Web

Website
  1. Crane T
(2005) The Problem of Perception
The Stanford Encyclopedia of Philosophy

Article Assessment Terms

Significance of the findings:
Valuable: Contains findings that have theoretical or practical implications for a subfield.
  • Landmark
  • Fundamental
  • Important
  • Valuable
  • Useful

About Profile

[Do not use this base pattern directly: see the following variants of this pattern for usage]

About Profile Image

Randy Scheckman

Editor-in-Chief

Lorem ipsum dolor sit amet, consectetur adipiscing elit. Mauris tempor euismod mi. Morbi facilisis eros in mi consequat cursus. Nulla malesuada pretium mauris, vitae gravida diam laoreet ac. Curabitur ornare libero sed porta molestie. Ut ut sem in libero tincidunt lobortis. Nullam eros nisi, malesuada vitae leo sit amet, bibendum congue justo. Morbi iaculis lectus erat, vel dapibus metus posuere sit amet. Phasellus eget scelerisque massa. Mauris hendrerit ex in nisl ultricies elementum. Donec tellus risus, rhoncus molestie rutrum et, cursus eget mi. Praesent et elit tellus. Curabitur id sodales turpis. Fusce pulvinar aliquam commodo. Cras vitae dolor vitae metus dignissim auctor.Cras nulla purus, rhoncus et mollis in, imperdiet sed metus. In non porttitor nibh. In sit amet ipsum eget nisl laoreet tincidunt. Donec iaculis nibh quis lacus viverra sagittis. Phasellus imperdiet congue imperdiet.

Interdum et malesuada fames ac ante ipsum primis in faucibus. Nunc nisi tortor, rhoncus.

Expertise
Cell Biology
Competing interests statement
Donec tellus

About Profile No Image

Randy Scheckman

Editor-in-Chief

Lorem ipsum dolor sit amet, consectetur adipiscing elit. Mauris tempor euismod mi. Morbi facilisis eros in mi consequat cursus. Nulla malesuada pretium mauris, vitae gravida diam laoreet ac. Curabitur ornare libero sed porta molestie. Ut ut sem in libero tincidunt lobortis. Nullam eros nisi, malesuada vitae leo sit amet, bibendum congue justo. Morbi iaculis lectus erat, vel dapibus metus posuere sit amet. Phasellus eget scelerisque massa. Mauris hendrerit ex in nisl ultricies elementum. Donec tellus risus, rhoncus molestie rutrum et, cursus eget mi. Praesent et elit tellus. Curabitur id sodales turpis. Fusce pulvinar aliquam commodo. Cras vitae dolor vitae metus dignissim auctor.Cras nulla purus, rhoncus et mollis in, imperdiet sed metus. In non porttitor nibh. In sit amet ipsum eget nisl laoreet tincidunt. Donec iaculis nibh quis lacus viverra sagittis. Phasellus imperdiet congue imperdiet.

Interdum et malesuada fames ac ante ipsum primis in faucibus. Nunc nisi tortor, rhoncus.

Expertise
Cell Biology
Competing interests statement
Donec tellus

About Profile Placeholder Image

Randy Scheckman

Editor-in-Chief

Lorem ipsum dolor sit amet, consectetur adipiscing elit. Mauris tempor euismod mi. Morbi facilisis eros in mi consequat cursus. Nulla malesuada pretium mauris, vitae gravida diam laoreet ac. Curabitur ornare libero sed porta molestie. Ut ut sem in libero tincidunt lobortis. Nullam eros nisi, malesuada vitae leo sit amet, bibendum congue justo. Morbi iaculis lectus erat, vel dapibus metus posuere sit amet. Phasellus eget scelerisque massa. Mauris hendrerit ex in nisl ultricies elementum. Donec tellus risus, rhoncus molestie rutrum et, cursus eget mi. Praesent et elit tellus. Curabitur id sodales turpis. Fusce pulvinar aliquam commodo. Cras vitae dolor vitae metus dignissim auctor.Cras nulla purus, rhoncus et mollis in, imperdiet sed metus. In non porttitor nibh. In sit amet ipsum eget nisl laoreet tincidunt. Donec iaculis nibh quis lacus viverra sagittis. Phasellus imperdiet congue imperdiet.

Interdum et malesuada fames ac ante ipsum primis in faucibus. Nunc nisi tortor, rhoncus.

Expertise
Cell Biology
Competing interests statement
Donec tellus

Additional Asset

[Do not use this base pattern directly: see the following variants of this pattern for usage]
.

Additional Asset Doi

Table 1 - source data 1.

Is the species name mentioned in the title, impact statement, abstract and digest of eLife papers (July–Sept 2014)?

some more details here
https://doi.org/10.7554/eLife.10181.001

Additional Asset Non Doi

Table 1 - source data 1.

Is the species name mentioned in the title, impact statement, abstract and digest of eLife papers (July–Sept 2014)?

some more details here
https://example.com/a-non-doi-link

Article Download Links List

A three part list of links to download the article, or parts of the article, in various formats.

Downloads (links to download the article or parts of the article as PDF, and in DAR format)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Lee R Berger
  2. John Hawks
  3. Darryl J de Ruiter
  4. Steven E Churchill
  5. Peter Schmid
  6. Lucas K Delezene
  7. Tracy L Kivell
  8. Heather M Garvin
  9. Scott A Williams
  10. Jeremy M DeSilva
  11. Matthew M Skinner
  12. Charles M Musiba
  13. Noel Cameron
  14. Trenton W Holliday
  15. William Harcourt-Smith
  16. Rebecca R Ackermann
  17. Markus Bastir
  18. Barry Bogin
  19. Debra Bolter
  20. Juliet Brophy
  21. Zachary D Cofran
  22. Kimberly A Congdon
  23. Andrew S Deane
  24. Mana Dembo
  25. Michelle Drapeau
  26. Marina C Elliott
  27. Elen M Feuerriegel
  28. Daniel Garcia-Martinez
  29. David J Green
  30. Alia Gurtov
  31. Joel D Irish
  32. Ashley Kruger
  33. Myra F Laird
  34. Damiano Marchi
  35. Marc R Meyer
  36. Shahed Nalla
  37. Enquye W Negash
  38. Caley M Orr
  39. Davorka Radovcic
  40. Lauren Schroeder
  41. Jill E Scott
  42. Zachary Throckmorton
  43. Matthew W Tocheri
  44. Caroline VanSickle
  45. Christopher S Walker
  46. Pianpian Wei
  47. Bernhard Zipfel
(2015)
Homo naledi, a new species of the genus Homo from the Dinaledi Chamber, South Africa
eLife 4:e09560.
https://doi.org/10.7554/eLife.09560

Article Meta

Article Section Kitchen Sink

The Kitchen Sink

Some link

Heading 1

Heading 2

Heading 3

Heading 4

Heading 5
Heading 6

This is not wrapped in a paragraph.

This is in a paragraph. Lorem ipsum dolor sit amet, test link adipiscing elit. This is strong. Nullam dignissim convallis est. This is underlined. Quisque aliquam. This is emphasized. Donec faucibus. This is monospace. Nunc iaculis suscipit dui. 53 = 125. Water is H2O. Nam sit amet sem. This is in small caps. Aliquam libero nisi, imperdiet at, tincidunt nec, gravida vehicula, nisl. The New York Times (That’s a citation). This is blue. Maecenas ornare tortor. This is purple. Donec sed tellus eget sapien fringilla nonummy. This is red. Mauris a ante. Suspendisse quam sem, consequat at, commodo vitae, feugiat in, nunc. Morbi imperdiet augue quis tellus.

HTML and CSS are our tools. Mauris a ante. Suspendisse quam sem, consequat at, commodo vitae, TAATAAGGAAGAACTGCTTATTCTTAATTATTTCTACCTACTAAACTAACTAATTATCAACAAATATCATCTATTTAATAGTATATCATCACATGCGGTGTAAGAGGATGACATAAAGATTGAGAAACAGTCATCCAGTCTAATGGAAGCTCAAATGCAAGGGCTGATAATGTAATAGGATAATGAATGACAACGTATAAAAGGAAAGAAGATAAAGCAATATTATTTTGTAGAATTATCGATTCCCTTTTGTGGATCCCTATATCCTCGAGGAGAA feugiat in, nunc. Morbi imperdiet augue quis tellus. Praesent mattis, massa quis luctus fermentum, turpis mi volutpat justo, eu volutpat enim diam eget metus. To copy a file type COPY filename. Dinner’s at 5:00. Let’s make that 7. This text has been struck.


List Types

Definition List

Definition List Title
This is a definition list division.
Definition
An exact statement or description of the nature, scope, or meaning of something: our definition of what constitutes poetry.

Ordered List

  1. List Item 1
  2. List Item 2
    1. Nested list item A
    2. Nested list item B
  3. List Item 3

Unordered List

  • List Item 1
  • List Item 2
    • Nested list item A
    • Nested list item B
  • List Item 3

Table

Table Header 1 Table Header 2 Table Header 3 Table Header 4
Division 1 Division 2 Division 3 Division 4
Division 1 Division 2 Division 3 Division 4
Division 1 Division 2 Division 3 with link Division 4 with link
This is blue. This is green. This is orange. This is yellow.
This is purple. This is red. This is pink. This is grey.

Preformatted Text

Typographically, preformatted text is not the same thing as code. Sometimes, a faithful execution of the text requires preformatted text that may not have anything to do with code. Most browsers use Courier and that’s a good default — with one slight adjustment, Courier 10 Pitch over regular Courier for Linux users. For example:

“Beware the Jabberwock, my son!
  The jaws that bite, the claws that catch!
Beware the Jubjub bird, and shun
  The frumious Bandersnatch!”

Code

Code can be presented inline, like <?php bloginfo('stylesheet_url'); ?>, or within a <pre> block. Because we have more specific typographic needs for code, we’ll specify Consolas and Monaco ahead of the browser-defined monospace font.

#container {
  float: left;
  margin: 0 -240px 0 0;
  width: 100%;
}
    

Blockquotes

Let’s keep it simple. Italics are good to help set it off from the body text. Be sure to style the citation.

Good afternoon, gentlemen. I am a HAL 9000 computer. I became operational at the H.A.L. plant in Urbana, Illinois on the 12th of January 1992. My instructor was Mr. Langley, and he taught me to sing a song. If you’d like to hear it I can sing it for you.

— Citing HAL 9000

And here’s a bit of trailing text.

Article Section

[Do not use this base pattern directly: see the following variants of this pattern for usage]

Article Section Assessment

Assessment

This valuable paper informs on the role of type I PRMTs in programming muscle stem cell identification. The evidence presented is mostly solid, with some weaknesses in the evidence regarding the proposed mechanism. The paper will be of particular interest to those who study skeletal muscle satellite cell biology.

https://doi.org/10.7554/eLife.62927.sa1

Article Section Default

Introduction

TNF Receptor Associated Factor 2 (TRAF2) is an adaptor protein that transduces signals following ligation of certain cytokine receptors including those binding TNF. It was first identified together with TRAF1 as a component of TNF receptor-2 and then TNF receptor-1 (TNFR1) signalling complexes (Rothe et al., 1994; Shu et al., 1996). TRAF2, like most other TRAFs, contains a RING domain, several zinc fingers, a TRAF-N, and a conserved TRAF-C domain which is responsible for oligomerisation and receptor binding through its MATH region (Takeuchi et al., 1996; Uren and Vaux, 1996).

RING domains are nearly always associated with ubiquitin E3 ligase activity (Shi and Kehrl, 2003) and TRAF2 can promote ubiquitylation of RIPK1 in TNFR1 signalling complexes (TNFR1-SC) (Wertz et al., 2004). However TRAF2 recruits E3 ligases such as cIAPs to TNFR1-SC and these have also been shown to be able to ubiquitylate RIPK1 and regulate TNF signalling (Dynek et al., 2010; Mahoney et al., 2008; Varfolomeev et al., 2008; Vince et al., 2009). This makes it difficult to unambiguously determine the role of the E3 ligase activity of TRAF2.

Activation of JNK and NF-κB by TNF is reduced in cells from Traf2-/- mice while only JNK signalling was affected in lymphocytes from transgenic mice that express a dominant negative (DN) form of TRAF2 that lacks the RING domain (Lee et al., 1997; Yeh et al., 1997). Traf2-/-Traf5-/- mouse embryonic fibroblasts (MEFs) have a pronounced defect in activation of NF-κB by TNF, suggesting that absence of TRAF2 can be compensated by TRAF5 (Tada et al., 2001). Although activation of NF-κB was restored in Traf2-/-Traf5-/- cells by re-expression of wild type TRAF2, it was not restored when the cells were reconstituted with TRAF2 point mutants that could not bind cIAPs (Vince et al., 2009; Zhang et al., 2010). These data, together with a wealth of different lines of evidence showing that cIAPs are critical E3 ligases required for TNF-induced canonical NF-κB (Blackwell et al., 2013; Haas et al., 2009; Silke, 2011), support the idea that the main function of TRAF2 in TNF-induced NF-κB is to recruit cIAPs to the TNFR1-SC. However, it remains possible that the RING of TRAF2 plays another function, such as in activating JNK and protecting cells from TNF-induced cell death (Vince et al., 2009; Zhang et al., 2010). Furthermore it has been shown that TRAF2 can K48-ubiquitylate caspase-8 to set the threshold for TRAIL or Fas induced cell death (Gonzalvez et al., 2012). Moreover, TRAF2 inhibits non-canonical NF-κB signalling (Grech et al., 2004; Zarnegar et al., 2008) and this function requires the RING domain of TRAF2 to induce proteosomal degradation of NIK (Vince et al., 2009). However, structural and in vitro analyses indicate that, unlike TRAF6, the RING domain of TRAF2 is unable to bind E2 conjugating enzymes (Yin et al., 2009), and is therefore unlikely to have intrinsic E3 ligase activity.

Sphingosine-1-phosphate (S1P) is a pleiotropic sphingolipid mediator that regulates proliferation, differentiation, cell trafficking and vascular development (Pitson, 2011). S1P is generated by sphingosine kinase 1 and 2 (SPHK1 and SPHK2) (Kohama et al., 1998; Liu et al., 2000). Extracellular S1P mainly acts by binding to its five G protein-coupled receptors S1P1-5 (Hla and Dannenberg, 2012). However, some intracellular roles have been suggested for S1P, including the blocking of the histone deacetylases, HDAC1/2 (Hait et al., 2009) and the induction of apoptosis through interaction with BAK and BAX (Chipuk et al., 2012).

Recently, it was suggested that the RING domain of TRAF2 requires S1P as a co-factor for its E3 ligase activity (Alvarez et al., 2010). Alvarez and colleagues proposed that SPHK1 but not SPHK2 is activated by TNF and phosphorylates sphingosine to S1P which in turn binds to the RING domain of TRAF2 and serves as an essential co-factor that was missing in the experiments of Yin et al. Alvarez and colleagues, observed that in the absence of SPHK1, TNF-induced NF-κB activation was completely abolished.

Although we know a lot about TRAF2, there are still important gaps particularly with regard to cell type specificity and in vivo function of TRAF2. Moreover, despite the claims that SPHK1 and its product, S1P, are required for TRAF2 to function as a ubiquitin ligase, the responses of Traf2-/- and Sphk1-/- cells to TNF were not compared. Therefore, we undertook an analysis of TRAF2 and SPHK1 function in TNF signalling in a number of different tissues.

Surprisingly, we found that neither TRAF2 nor SPHK1 are required for TNF mediated canonical NF-κB and MAPK signalling in macrophages. However, MEFs, murine dermal fibroblasts (MDFs) and keratinocytes required TRAF2 but not SPHK1 for full strength TNF signalling. In these cell types, absence of TRAF2 caused a delay in TNF-induced activation of NF-κB and MAPK, and sensitivity to killing by TNF was increased. Absence of TRAF2 in keratinocytes in vivo resulted in psoriasis-like epidermal hyperplasia and skin inflammation. Unlike TNF-dependent genetic inflammatory skin conditions, such as IKK2 epidermal knock-out (Pasparakis et al., 2002) and the cpdm mutant (Gerlach et al., 2011), the onset of inflammation was only delayed, and not prevented by deletion of TNF. This early TNF-dependent inflammation is caused by excessive apoptotic but not necroptotic cell death and could be prevented by deletion of Casp8. We observed constitutive activation of NIK and non-canonical NF-κB in Traf2-/- keratinocytes which caused production of inflammatory cytokines and chemokines. We were able to reverse this inflammatory phenotype by simultaneously deleting both Tnf and Nfkb2 genes. Our results highlight the important role TRAF2 plays to protect keratinocytes from cell death and to down-regulate inflammatory responses and support the idea that intrinsic defects in keratinocytes can initiate psoriasis-like skin inflammation.

https://doi.org/10.7554/eLife.16370

Article Section Editor Evaluation

Editor's evaluation

The manuscript by Rosello et al. represents a major advance in implementation of cutting-edge genome editing methodologies in the zebrafish. The study seeks to describe optimized tools for precise base editing in zebrafish and to demonstrate their effective application. Overall, this study demonstrates that cytosine base editing is an efficient and powerful method for introducing precise in vivo edits into the zebrafish genome, and will be of interest to scientists who use zebrafish and other genetic systems to model human development and disease.

https://doi.org/10.7554/eLife.62927.sa1

Article Section Editor Title Text

Senior editor
  1. Dominique Soldati-Favre
  2. University of Geneva, Switzerland

Article Section Header Link

TNF Receptor Associated Factor 2 (TRAF2) is an adaptor protein that transduces signals following ligation of certain cytokine receptors

some text to carry a link

TNF Receptor Associated Factor 2 (TRAF2) is an adaptor protein that transduces signals following ligation of certain cytokine receptors including those binding TNF. It was first identified together with TRAF1 as a component of TNF receptor-2 and then TNF receptor-1 (TNFR1) signalling complexes (Rothe et al., 1994; Shu et al., 1996). TRAF2, like most other TRAFs, contains a RING domain, several zinc fingers, a TRAF-N, and a conserved TRAF-C domain which is responsible for oligomerisation and receptor binding through its MATH region (Takeuchi et al., 1996; Uren and Vaux, 1996).

RING domains are nearly always associated with ubiquitin E3 ligase activity (Shi and Kehrl, 2003) and TRAF2 can promote ubiquitylation of RIPK1 in TNFR1 signalling complexes (TNFR1-SC) (Wertz et al., 2004). However TRAF2 recruits E3 ligases such as cIAPs to TNFR1-SC and these have also been shown to be able to ubiquitylate RIPK1 and regulate TNF signalling (Dynek et al., 2010; Mahoney et al., 2008; Varfolomeev et al., 2008; Vince et al., 2009). This makes it difficult to unambiguously determine the role of the E3 ligase activity of TRAF2.

Activation of JNK and NF-κB by TNF is reduced in cells from Traf2-/- mice while only JNK signalling was affected in lymphocytes from transgenic mice that express a dominant negative (DN) form of TRAF2 that lacks the RING domain (Lee et al., 1997; Yeh et al., 1997). Traf2-/-Traf5-/- mouse embryonic fibroblasts (MEFs) have a pronounced defect in activation of NF-κB by TNF, suggesting that absence of TRAF2 can be compensated by TRAF5 (Tada et al., 2001). Although activation of NF-κB was restored in Traf2-/-Traf5-/- cells by re-expression of wild type TRAF2, it was not restored when the cells were reconstituted with TRAF2 point mutants that could not bind cIAPs (Vince et al., 2009; Zhang et al., 2010). These data, together with a wealth of different lines of evidence showing that cIAPs are critical E3 ligases required for TNF-induced canonical NF-κB (Blackwell et al., 2013; Haas et al., 2009; Silke, 2011), support the idea that the main function of TRAF2 in TNF-induced NF-κB is to recruit cIAPs to the TNFR1-SC. However, it remains possible that the RING of TRAF2 plays another function, such as in activating JNK and protecting cells from TNF-induced cell death (Vince et al., 2009; Zhang et al., 2010). Furthermore it has been shown that TRAF2 can K48-ubiquitylate caspase-8 to set the threshold for TRAIL or Fas induced cell death (Gonzalvez et al., 2012). Moreover, TRAF2 inhibits non-canonical NF-κB signalling (Grech et al., 2004; Zarnegar et al., 2008) and this function requires the RING domain of TRAF2 to induce proteosomal degradation of NIK (Vince et al., 2009). However, structural and in vitro analyses indicate that, unlike TRAF6, the RING domain of TRAF2 is unable to bind E2 conjugating enzymes (Yin et al., 2009), and is therefore unlikely to have intrinsic E3 ligase activity.

Sphingosine-1-phosphate (S1P) is a pleiotropic sphingolipid mediator that regulates proliferation, differentiation, cell trafficking and vascular development (Pitson, 2011). S1P is generated by sphingosine kinase 1 and 2 (SPHK1 and SPHK2) (Kohama et al., 1998; Liu et al., 2000). Extracellular S1P mainly acts by binding to its five G protein-coupled receptors S1P1-5 (Hla and Dannenberg, 2012). However, some intracellular roles have been suggested for S1P, including the blocking of the histone deacetylases, HDAC1/2 (Hait et al., 2009) and the induction of apoptosis through interaction with BAK and BAX (Chipuk et al., 2012).

Recently, it was suggested that the RING domain of TRAF2 requires S1P as a co-factor for its E3 ligase activity (Alvarez et al., 2010). Alvarez and colleagues proposed that SPHK1 but not SPHK2 is activated by TNF and phosphorylates sphingosine to S1P which in turn binds to the RING domain of TRAF2 and serves as an essential co-factor that was missing in the experiments of Yin et al. Alvarez and colleagues, observed that in the absence of SPHK1, TNF-induced NF-κB activation was completely abolished.

Although we know a lot about TRAF2, there are still important gaps particularly with regard to cell type specificity and in vivo function of TRAF2. Moreover, despite the claims that SPHK1 and its product, S1P, are required for TRAF2 to function as a ubiquitin ligase, the responses of Traf2-/- and Sphk1-/- cells to TNF were not compared. Therefore, we undertook an analysis of TRAF2 and SPHK1 function in TNF signalling in a number of different tissues.

Surprisingly, we found that neither TRAF2 nor SPHK1 are required for TNF mediated canonical NF-κB and MAPK signalling in macrophages. However, MEFs, murine dermal fibroblasts (MDFs) and keratinocytes required TRAF2 but not SPHK1 for full strength TNF signalling. In these cell types, absence of TRAF2 caused a delay in TNF-induced activation of NF-κB and MAPK, and sensitivity to killing by TNF was increased. Absence of TRAF2 in keratinocytes in vivo resulted in psoriasis-like epidermal hyperplasia and skin inflammation. Unlike TNF-dependent genetic inflammatory skin conditions, such as IKK2 epidermal knock-out (Pasparakis et al., 2002) and the cpdm mutant (Gerlach et al., 2011), the onset of inflammation was only delayed, and not prevented by deletion of TNF. This early TNF-dependent inflammation is caused by excessive apoptotic but not necroptotic cell death and could be prevented by deletion of Casp8. We observed constitutive activation of NIK and non-canonical NF-κB in Traf2-/- keratinocytes which caused production of inflammatory cytokines and chemokines. We were able to reverse this inflammatory phenotype by simultaneously deleting both Tnf and Nfkb2 genes. Our results highlight the important role TRAF2 plays to protect keratinocytes from cell death and to down-regulate inflammatory responses and support the idea that intrinsic defects in keratinocytes can initiate psoriasis-like skin inflammation.

Article Section Process Block

Peer review process

This article was published via eLife's original peer review and publishing model, which was phased out in 2023. eLife's editors accepted this article for publication after peer review and was subject to mandatory revision requests before it was published.

History

  • Version of Record published
  • Preprint posted
  • Preprint posted
  • Preprint posted
  • Sent for peer review

Article Section Related Items Separator Circle

eLife assessment

Collagen is a major component of extracellular matrix. The authors have identified a high-affinity inhibitory collagen receptor LAIR-1 and a soluble decoy receptor LAIR-2 (with even higher binding affinity to collagen), which can be therapeutically targeted to block tumor progression. Dr Meyaard and colleagues have also generated a dimeric LAIR-2 human IgG1 Fc fusion protein NC410 for therapeutic use. With humanized mouse models engrafted with functional human immune systems (PBMC), they have explored the anti-cancer efficacy of NC410 and revealed its impact on modulating immune responses. Furthermore, they extended this study to identify biomarkers of predictive value for NC410-based anti-cancer therapy.

https://doi.org/10.7554/eLife.16370

Article Section Without Title

TNF Receptor Associated Factor 2 (TRAF2) is an adaptor protein that transduces signals following ligation of certain cytokine receptors including those binding TNF. It was first identified together with TRAF1 as a component of TNF receptor-2 and then TNF receptor-1 (TNFR1) signalling complexes (Rothe et al., 1994; Shu et al., 1996). TRAF2, like most other TRAFs, contains a RING domain, several zinc fingers, a TRAF-N, and a conserved TRAF-C domain which is responsible for oligomerisation and receptor binding through its MATH region (Takeuchi et al., 1996; Uren and Vaux, 1996).

RING domains are nearly always associated with ubiquitin E3 ligase activity (Shi and Kehrl, 2003) and TRAF2 can promote ubiquitylation of RIPK1 in TNFR1 signalling complexes (TNFR1-SC) (Wertz et al., 2004). However TRAF2 recruits E3 ligases such as cIAPs to TNFR1-SC and these have also been shown to be able to ubiquitylate RIPK1 and regulate TNF signalling (Dynek et al., 2010; Mahoney et al., 2008; Varfolomeev et al., 2008; Vince et al., 2009). This makes it difficult to unambiguously determine the role of the E3 ligase activity of TRAF2.

Activation of JNK and NF-κB by TNF is reduced in cells from Traf2-/- mice while only JNK signalling was affected in lymphocytes from transgenic mice that express a dominant negative (DN) form of TRAF2 that lacks the RING domain (Lee et al., 1997; Yeh et al., 1997). Traf2-/-Traf5-/- mouse embryonic fibroblasts (MEFs) have a pronounced defect in activation of NF-κB by TNF, suggesting that absence of TRAF2 can be compensated by TRAF5 (Tada et al., 2001). Although activation of NF-κB was restored in Traf2-/-Traf5-/- cells by re-expression of wild type TRAF2, it was not restored when the cells were reconstituted with TRAF2 point mutants that could not bind cIAPs (Vince et al., 2009; Zhang et al., 2010). These data, together with a wealth of different lines of evidence showing that cIAPs are critical E3 ligases required for TNF-induced canonical NF-κB (Blackwell et al., 2013; Haas et al., 2009; Silke, 2011), support the idea that the main function of TRAF2 in TNF-induced NF-κB is to recruit cIAPs to the TNFR1-SC. However, it remains possible that the RING of TRAF2 plays another function, such as in activating JNK and protecting cells from TNF-induced cell death (Vince et al., 2009; Zhang et al., 2010). Furthermore it has been shown that TRAF2 can K48-ubiquitylate caspase-8 to set the threshold for TRAIL or Fas induced cell death (Gonzalvez et al., 2012). Moreover, TRAF2 inhibits non-canonical NF-κB signalling (Grech et al., 2004; Zarnegar et al., 2008) and this function requires the RING domain of TRAF2 to induce proteosomal degradation of NIK (Vince et al., 2009). However, structural and in vitro analyses indicate that, unlike TRAF6, the RING domain of TRAF2 is unable to bind E2 conjugating enzymes (Yin et al., 2009), and is therefore unlikely to have intrinsic E3 ligase activity.

Sphingosine-1-phosphate (S1P) is a pleiotropic sphingolipid mediator that regulates proliferation, differentiation, cell trafficking and vascular development (Pitson, 2011). S1P is generated by sphingosine kinase 1 and 2 (SPHK1 and SPHK2) (Kohama et al., 1998; Liu et al., 2000). Extracellular S1P mainly acts by binding to its five G protein-coupled receptors S1P1-5 (Hla and Dannenberg, 2012). However, some intracellular roles have been suggested for S1P, including the blocking of the histone deacetylases, HDAC1/2 (Hait et al., 2009) and the induction of apoptosis through interaction with BAK and BAX (Chipuk et al., 2012).

Recently, it was suggested that the RING domain of TRAF2 requires S1P as a co-factor for its E3 ligase activity (Alvarez et al., 2010). Alvarez and colleagues proposed that SPHK1 but not SPHK2 is activated by TNF and phosphorylates sphingosine to S1P which in turn binds to the RING domain of TRAF2 and serves as an essential co-factor that was missing in the experiments of Yin et al. Alvarez and colleagues, observed that in the absence of SPHK1, TNF-induced NF-κB activation was completely abolished.

Although we know a lot about TRAF2, there are still important gaps particularly with regard to cell type specificity and in vivo function of TRAF2. Moreover, despite the claims that SPHK1 and its product, S1P, are required for TRAF2 to function as a ubiquitin ligase, the responses of Traf2-/- and Sphk1-/- cells to TNF were not compared. Therefore, we undertook an analysis of TRAF2 and SPHK1 function in TNF signalling in a number of different tissues.

Surprisingly, we found that neither TRAF2 nor SPHK1 are required for TNF mediated canonical NF-κB and MAPK signalling in macrophages. However, MEFs, murine dermal fibroblasts (MDFs) and keratinocytes required TRAF2 but not SPHK1 for full strength TNF signalling. In these cell types, absence of TRAF2 caused a delay in TNF-induced activation of NF-κB and MAPK, and sensitivity to killing by TNF was increased. Absence of TRAF2 in keratinocytes in vivo resulted in psoriasis-like epidermal hyperplasia and skin inflammation. Unlike TNF-dependent genetic inflammatory skin conditions, such as IKK2 epidermal knock-out (Pasparakis et al., 2002) and the cpdm mutant (Gerlach et al., 2011), the onset of inflammation was only delayed, and not prevented by deletion of TNF. This early TNF-dependent inflammation is caused by excessive apoptotic but not necroptotic cell death and could be prevented by deletion of Casp8. We observed constitutive activation of NIK and non-canonical NF-κB in Traf2-/- keratinocytes which caused production of inflammatory cytokines and chemokines. We were able to reverse this inflammatory phenotype by simultaneously deleting both Tnf and Nfkb2 genes. Our results highlight the important role TRAF2 plays to protect keratinocytes from cell death and to down-regulate inflammatory responses and support the idea that intrinsic defects in keratinocytes can initiate psoriasis-like skin inflammation.

Assessment

Audio Player

Authors Details

Author details

  1. Jenny Bloggs

    1. Evolutionary Studies Institute and Centre of Excellence in PalaeoSciences, University of the Witwatersrand, Johannesburg, South Africa
    2. School of Geosciences, University of the Witwatersrand, Johannesburg, South Africa
    Present addresses
    1. Department of Inventive Inventions, Univertity of Wessex, Windowchester, Wessex
    Contribution
    Conception and design, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article, Contributed unpublished essential data or reagents
    For correspondence
    1. jenny@bloggs.com
    2. +1 555-4321-09876
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-3400-7927
  2. ICGC Chronic Myeloid Disorders Group

    1. Cancer Genome Project, Wellcome Trust Sanger Institute, Hinxton, United Kingdom
    Competing interests
    No competing interests declared
    1. Luca Malcovati, Fondazione IRCCS Policlinico San Matteo, University of Pavia, Pavia, Italy
    2. Sudhir Tauro, Division of Medial Sciences, University of Dundee, Dundee, UK
    3. Jacqueline Boultwood, Nuffield Department of Clinical Laboratory Sciences, University of Oxford, UK

Authors

  1. Lee R Berger  Is a corresponding author
  2. John Hawks
  3. Darryl J de Ruiter
  4. Steven E Churchill
  5. Peter Schmid
  6. Lucas K Delezene
  7. Tracy L Kivell
  8. Heather M Garvin
  9. Scott A Williams
  10. Jeremy M DeSilva
  11. Matthew M Skinner
  12. Charles M Musiba
  13. Noel Cameron
  14. Trenton W Holliday
  15. William Harcourt-Smith
  16. Rebecca R Ackermann
  17. Markus Bastir
  18. Barry Bogin
  19. Debra Bolter
  20. Juliet Brophy
  21. Zachary D Cofran
  22. Kimberly A Congdon
  23. Andrew S Deane
  24. Mana Dembo
  25. Michelle Drapeau
  26. Marina C Elliott
  27. Elen M Feuerriegel
  28. Daniel Garcia-Martinez
  29. David J Green
  30. Alia Gurtov
  31. Joel D Irish
  32. Ashley Kruger
  33. Myra F Laird
  34. Damiano Marchi
  35. Marc R Meyer
  36. Shahed Nalla
  37. Enquye W Negash
  38. Caley M Orr
  39. Davorka Radovcic
  40. Lauren Schroeder
  41. Jill E Scott
  42. Zachary Throckmorton
  43. Caroline VanSickle
  44. Christopher S Walker
  45. Pianpian Wei
  46. Bernhard Zipfel  Is a corresponding author
  1. University of the Witwatersrand, South Africa
  2. University of Wisconsin-Madison, United States
  3. Texas A&M University, United States
  4. Duke University, United States
  5. University of Zurich, Switzerland
  6. University of Arkansas, United States
  7. University of Kent, United Kingdom
  8. Max Planck Institute for Evolutionary Anthropology, Germany
  9. Mercyhurst University, United States
  10. New York University, United States
  11. New York Consortium in Evolutionary Primatology, United States
  12. Dartmouth College, United States
  13. University of Colorado Denver, United States
  14. Loughborough University, United Kingdom
  15. Tulane University, United States
  16. Lehman College, United States
  17. American Museum of Natural History, United States
  18. University of Cape Town, South Africa
  19. Museo Nacional de Ciencias Naturales, Spain
  20. Modesto Junior College, United States
  21. Louisiana State University, United States
  22. Nazarbayev University, Kazakhstan
  23. University of Missouri, United States
  24. University of Kentucky College of Medicine, United States
  25. Simon Fraser University, Canada
  26. Université de Montréal, Canada
  27. Australian National University, Australia
  28. Biology Department, Universidad Autònoma de Madrid, Spain
  29. Midwestern University, United States
  30. Liverpool John Moores University, United Kingdom
  31. University of Pisa, Italy
  32. Chaffey College, United States
  33. University of Johannesburg, South Africa
  34. George Washington University, United States
  35. University of Colorado School of Medicine, United States
  36. Croatian Natural History Museum, Croatia
  37. University of Iowa, United States
  38. Lincoln Memorial University, United States
  39. Smithsonian Institution, United States

Authors Between Three And Ten Authors

  1. Lee R Berger  Is a corresponding author
  2. John Hawks
  3. Darryl J de Ruiter
  4. Steven E Churchill
  5. Peter Schmid
  1. University of the Witwatersrand, South Africa
  2. University of Wisconsin-Madison, United States
  3. Texas A&M University, United States
  4. Duke University, United States
  5. University of Zurich, Switzerland
  6. University of Arkansas, United States
  7. University of Kent, United Kingdom
  8. Max Planck Institute for Evolutionary Anthropology, Germany
  9. Mercyhurst University, United States
  10. New York University, United States
  11. New York Consortium in Evolutionary Primatology, United States
  12. Dartmouth College, United States
  13. University of Colorado Denver, United States
  14. Loughborough University, United Kingdom
  15. Tulane University, United States
  16. Lehman College, United States
  17. American Museum of Natural History, United States
  18. University of Cape Town, South Africa
  19. Museo Nacional de Ciencias Naturales, Spain
  20. Modesto Junior College, United States
  21. Louisiana State University, United States
  22. Nazarbayev University, Kazakhstan
  23. University of Missouri, United States
  24. University of Kentucky College of Medicine, United States
  25. Simon Fraser University, Canada
  26. Université de Montréal, Canada
  27. Australian National University, Australia
  28. Biology Department, Universidad Autònoma de Madrid, Spain
  29. Midwestern University, United States
  30. Liverpool John Moores University, United Kingdom
  31. University of Pisa, Italy
  32. Chaffey College, United States
  33. University of Johannesburg, South Africa
  34. George Washington University, United States
  35. University of Colorado School of Medicine, United States
  36. Croatian Natural History Museum, Croatia
  37. University of Iowa, United States
  38. Lincoln Memorial University, United States
  39. Smithsonian Institution, United States

Authors Less Then Three Authors

  1. Lee R Berger  Is a corresponding author
  2. John Hawks
  1. University of the Witwatersrand, South Africa
  2. University of Wisconsin-Madison, United States
  3. Texas A&M University, United States
  4. Duke University, United States
  5. University of Zurich, Switzerland
  6. University of Arkansas, United States
  7. University of Kent, United Kingdom
  8. Max Planck Institute for Evolutionary Anthropology, Germany
  9. Mercyhurst University, United States
  10. New York University, United States
  11. New York Consortium in Evolutionary Primatology, United States
  12. Dartmouth College, United States
  13. University of Colorado Denver, United States
  14. Loughborough University, United Kingdom
  15. Tulane University, United States
  16. Lehman College, United States
  17. American Museum of Natural History, United States
  18. University of Cape Town, South Africa
  19. Museo Nacional de Ciencias Naturales, Spain
  20. Modesto Junior College, United States
  21. Louisiana State University, United States
  22. Nazarbayev University, Kazakhstan
  23. University of Missouri, United States
  24. University of Kentucky College of Medicine, United States
  25. Simon Fraser University, Canada
  26. Université de Montréal, Canada
  27. Australian National University, Australia
  28. Biology Department, Universidad Autònoma de Madrid, Spain
  29. Midwestern University, United States
  30. Liverpool John Moores University, United Kingdom
  31. University of Pisa, Italy
  32. Chaffey College, United States
  33. University of Johannesburg, South Africa
  34. George Washington University, United States
  35. University of Colorado School of Medicine, United States
  36. Croatian Natural History Museum, Croatia
  37. University of Iowa, United States
  38. Lincoln Memorial University, United States
  39. Smithsonian Institution, United States

Bar Chart

Button Collection

  1. Button 1
  2. Button 2
  3. Button 3

Button Collection Centered

  1. Button 1
  2. Button 2
  3. Button 3

Button Collection Citation Modal

Button Collection Compact

  1. Button 1
  2. Button 2
  3. Button 3

Button Collection Inline

  1. Download
  2. Cite
  3. Share

Call To Action

Hear more about our new Editor-in-Chief, and the latest developments at eLife

Captioned Asset

[Do not use this base pattern directly: see the following variants of this pattern for usage]

Captioned Asset Iframe Figshare

Many features are conserved between the mammalian nephron and planarian protonephridia.

(A) Image of a young adult C. elegans and schematic depicting the twelve pairs of sensory neurons in the anterior amphid individuals carrying a virus with k deleterious mutations at its endemic equilibrium. class carrying the fewest number of deleterious mutations is defined as mutation class k = 0. Inset: variation in the basic reproductive rate of infected individuals (gray histogram) and variation in the net reproductive rate R of infected individuals (brown histogram) resulting from variation in the number of deleterious mutations carried by circulating viruses.

https://doi.org/10.7554/eLife.16370

Captioned Asset Iframe Google Map

Many features are conserved between the mammalian nephron and planarian protonephridia.

(A) Image of a young adult C. elegans and schematic depicting the twelve pairs of sensory neurons in the anterior amphid individuals carrying a virus with k deleterious mutations at its endemic equilibrium. class carrying the fewest number of deleterious mutations is defined as mutation class k = 0. Inset: variation in the basic reproductive rate of infected individuals (gray histogram) and variation in the net reproductive rate R of infected individuals (brown histogram) resulting from variation in the number of deleterious mutations carried by circulating viruses.

https://doi.org/10.7554/eLife.16370

Captioned Asset Iframe

Many features are conserved between the mammalian nephron and planarian protonephridia.

(A) Image of a young adult C. elegans and schematic depicting the twelve pairs of sensory neurons in the anterior amphid individuals carrying a virus with k deleterious mutations at its endemic equilibrium. class carrying the fewest number of deleterious mutations is defined as mutation class k = 0. Inset: variation in the basic reproductive rate of infected individuals (gray histogram) and variation in the net reproductive rate R of infected individuals (brown histogram) resulting from variation in the number of deleterious mutations carried by circulating viruses.

https://doi.org/10.7554/eLife.16370

Captioned Asset Image

Meaningful alt text here please.
Many features are conserved between the mammalian nephron and planarian protonephridia.

(A) Image of a young adult C. elegans and schematic depicting the twelve pairs of sensory neurons in the anterior amphid individuals carrying a virus with k deleterious mutations at its endemic equilibrium. class carrying the fewest number of deleterious mutations is defined as mutation class k = 0. Inset: variation in the basic reproductive rate of infected individuals (gray histogram) and variation in the net reproductive rate R of infected individuals (brown histogram) resulting from variation in the number of deleterious mutations carried by circulating viruses.

https://doi.org/10.7554/eLife.16370

Captioned Asset Inline Image

Meaningful alt text here please.
Many features are conserved between the mammalian nephron and planarian protonephridia.

(A) Image of a young adult C. elegans and schematic depicting the twelve pairs of sensory neurons in the anterior amphid individuals carrying a virus with k deleterious mutations at its endemic equilibrium. class carrying the fewest number of deleterious mutations is defined as mutation class k = 0. Inset: variation in the basic reproductive rate of infected individuals (gray histogram) and variation in the net reproductive rate R of infected individuals (brown histogram) resulting from variation in the number of deleterious mutations carried by circulating viruses.

https://doi.org/10.7554/eLife.16370

Captioned Asset Picture

Meaningful alt text here please.
Many features are conserved between the mammalian nephron and planarian protonephridia.

(A) Image of a young adult C. elegans and schematic depicting the twelve pairs of sensory neurons in the anterior amphid individuals carrying a virus with k deleterious mutations at its endemic equilibrium. class carrying the fewest number of deleterious mutations is defined as mutation class k = 0. Inset: variation in the basic reproductive rate of infected individuals (gray histogram) and variation in the net reproductive rate R of infected individuals (brown histogram) resulting from variation in the number of deleterious mutations carried by circulating viruses.

https://doi.org/10.7554/eLife.16370

Captioned Asset Table

Many features are conserved between the mammalian nephron and planarian protonephridia.

(A) Image of a young adult C. elegans and schematic depicting the twelve pairs of sensory neurons in the anterior amphid individuals carrying a virus with k deleterious mutations at its endemic equilibrium. class carrying the fewest number of deleterious mutations is defined as mutation class k = 0. Inset: variation in the basic reproductive rate of infected individuals (gray histogram) and variation in the net reproductive rate R of infected individuals (brown histogram) resulting from variation in the number of deleterious mutations carried by circulating viruses.

https://doi.org/10.7554/eLife.16370
F(Dfn, Dfd)Partial η2Original effect size fReplication total sample sizeDetectable effect size f
F(24,39) = 0.8678 (interaction)0.3481200.7307699169*0.3895070†
F(2,39) = 0.8075 (treatments)0.0397660.2035014169*0.2415459†
F(12,39) = 187.6811 (hematology parameters)0.9829787.599178169*0.3331365‡

Captioned Asset Tables

Many features are conserved between the mammalian nephron and planarian protonephridia.

(A) Image of a young adult C. elegans and schematic depicting the twelve pairs of sensory neurons in the anterior amphid individuals carrying a virus with k deleterious mutations at its endemic equilibrium. class carrying the fewest number of deleterious mutations is defined as mutation class k = 0. Inset: variation in the basic reproductive rate of infected individuals (gray histogram) and variation in the net reproductive rate R of infected individuals (brown histogram) resulting from variation in the number of deleterious mutations carried by circulating viruses.

https://doi.org/10.7554/eLife.16370
F(Dfn, Dfd)Partial η2Original effect size fReplication total sample sizeDetectable effect size f
F(24,39) = 0.8678 (interaction)0.3481200.7307699169*0.3895070†
F(2,39) = 0.8075 (treatments)0.0397660.2035014169*0.2415459†
F(12,39) = 187.6811 (hematology parameters)0.9829787.599178169*0.3331365‡
F(Dfn, Dfd)Partial η2Original effect size fReplication total sample sizeDetectable effect size f
F(24,39) = 0.8678 (interaction)0.3481200.7307699169*0.3895070†
F(2,39) = 0.8075 (treatments)0.0397660.2035014169*0.2415459†
F(12,39) = 187.6811 (hematology parameters)0.9829787.599178169*0.3331365‡

Captioned Asset Tweet

[Do not use this base pattern directly: see the following variants of this pattern for usage]

Captioned Asset Video

Many features are conserved between the mammalian nephron and planarian protonephridia.

(A) Image of a young adult C. elegans and schematic depicting the twelve pairs of sensory neurons in the anterior amphid individuals carrying a virus with k deleterious mutations at its endemic equilibrium. class carrying the fewest number of deleterious mutations is defined as mutation class k = 0. Inset: variation in the basic reproductive rate of infected individuals (gray histogram) and variation in the net reproductive rate R of infected individuals (brown histogram) resulting from variation in the number of deleterious mutations carried by circulating viruses.

https://doi.org/10.7554/eLife.16370

Compact Form

Compact Form Error

Please provide a valid value

Compact Form Info

You may wish to consider this

Contextual Data

  • Views 149
  • Cited 5
  • Annotations

Contextual Data With Citation

  • Views 149
  • Cited 5
  • Annotations
Cite this article as: eLife 2016;5:e16370 doi: 10.7554/eLife.16370

Contextual Data With Download

  • Views 149
  • Downloads 20
  • Cited 5
  • Annotations

Filter Group

Subject

Filter Group Dropdown

Floating Action Button

Highlight Item

  • Highlight Item Article Long Authors

  • Meaningful alt text please.

    Molecular basis for multimerization in the activation of the epidermal growth factor

    Summary

    Thisisanexample Ofareallylongauthorline, Todemonstrate Whatitlookslike ... Ifthis Valuewraps
    #
  • Highlight Item Article Poa

  • Meaningful alt text please.

    Molecular basis for multimerization in the activation of the epidermal growth factor

    Summary

    Yongjian Huang, Shashank Bharill ... John Kuriyan
    Research article
  • Highlight Item Article Vor

  • Meaningful alt text please.
  • Highlight Item Blog Article

  • Meaningful alt text please.

    More eLife authors are linking submissions to their ORCID iDs

    eLife sees positive results of requiring corresponding authors to register and link their profiles to their ORCID iDs

    Blog article
  • Highlight Item Collection With Summary

  • Meaningful alt text please.
  • Highlight Item Collection Without Summary

  • Meaningful alt text please.
  • Highlight Item Event

  • Meaningful alt text please.

    eLife Continuum webinar

    We're inviting all interested parties to participate in a webinar to learn about leveraging our new open-source publishing platform.

    Event
  • Highlight Item Interview

  • Meaningful alt text please.
  • Highlight Item Labs Post

  • Meaningful alt text please.
  • Highlight Item Podcast Episode

  • Meaningful alt text please.

    April/May 2016

    Summary

    Podcast episode
  • Highlight Item Press Pack

  • Meaningful alt text please.

    Scientists prove key aspect of evolutionary theory

    While this event was first predicted almost twenty years ago, evidence for it has proved elusive.

    Press pack
  • Highlight Item Reviewed Preprint

  • Meaningful alt text please.
  • Home Banner

    Inline Profile

    Lorem ipsum dolor sit amet, consectetur adipiscing elit. Mauris tempor euismod mi. Morbi facilisis eros in mi consequat cursus. Nulla malesuada pretium mauris, vitae gravida diam laoreet ac. Curabitur ornare libero sed porta molestie. Ut ut sem in libero tincidunt lobortis. Nullam eros nisi, malesuada vitae leo sit amet, bibendum congue justo. Morbi iaculis lectus erat, vel dapibus metus posuere sit amet. Phasellus eget scelerisque massa. Mauris hendrerit ex in nisl ultricies elementum. Donec tellus risus, rhoncus molestie rutrum et, cursus eget mi. Praesent et elit tellus. Curabitur id sodales turpis. Fusce pulvinar aliquam commodo. Cras vitae dolor vitae metus dignissim auctor.Cras nulla purus, rhoncus et mollis in, imperdiet sed metus. In non porttitor nibh. In sit amet ipsum eget nisl laoreet tincidunt. Donec iaculis nibh quis lacus viverra sagittis. Phasellus imperdiet congue imperdiet.

    Interdum et malesuada fames ac ante ipsum primis in faucibus. Nunc nisi tortor, rhoncus.

    Lorem ipsum dolor sit amet, consectetur adipiscing elit. Mauris tempor euismod mi. Morbi facilisis eros in mi consequat cursus. Nulla malesuada pretium mauris, vitae gravida diam laoreet ac. Curabitur ornare libero sed porta molestie. Ut ut sem in libero tincidunt lobortis. Nullam eros nisi, malesuada vitae leo sit amet, bibendum congue justo. Morbi iaculis lectus erat, vel dapibus metus posuere sit amet. Phasellus eget scelerisque massa. Mauris hendrerit ex in nisl ultricies elementum. Donec tellus risus, rhoncus molestie rutrum et, cursus eget mi. Praesent et elit tellus. Curabitur id sodales turpis. Fusce pulvinar aliquam commodo. Cras vitae dolor vitae metus dignissim auctor.Cras nulla purus, rhoncus et mollis in, imperdiet sed metus. In non porttitor nibh. In sit amet ipsum eget nisl laoreet tincidunt. Donec iaculis nibh quis lacus viverra sagittis. Phasellus imperdiet congue imperdiet.

    Interdum et malesuada fames ac ante ipsum primis in faucibus. Nunc nisi tortor, rhoncus.

    Investor Logos

    1. Meaningful alt text here please.
    2. Meaningful alt text here please.
    3. Meaningful alt text here please.
    4. Meaningful alt text here please.
    5. Meaningful alt text here please.

    Media Chapter Listing Item

    16:50
    Drosophila duet: mating flies harmonise
    Flies get to grips with acoustic duetting.
    This chapter is based on the following content

    Meta Journal

    Research article

    Meta

    Research article

    Meta Not Revised

    Not revised
    Reviewed Preprint v1
    Research article

    Meta Poa

    Accepted Manuscript
    Research article

    Meta Revised

    Revised
    Reviewed Preprint v3
    Research article

    Meta Vor New

    Version of Record
    Research article

    Meta Vor Old

    Version of Record
    Research article

    Mini Section

    [heading]

    [body]

    Personalised Cover Download

    Download your personalised magazine cover

    Thank you for publishing your research with us.

    As a small keepsake for you and your co-authors we hope you’ll download this free poster highlighting your paper on an eLife magazine style cover.

    Like your research it’s open access so you can print it, frame it, tweet it, use it as wallpaper in your lab...the possibilities are endless.

    Meaningful alt text here please.

    Profile Snippet

    Meaningful alt text here please.
    Name McNamerson
    Title McTitleson
    E: test.email@testemail.com

    Pull Quote

    Quote Incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris nisi ut reprehenderit in voluptate velit esse cillum dolore eu fugiat nulla pariatur.

    Excepteur sint est laborum.

    Pull Quote With Cite

    Quote Incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris nisi ut reprehenderit in voluptate velit esse cillum dolore eu fugiat nulla pariatur. Excepteur sint est laborum.

    May or may not be a link

    Quote

    Lorem ipsum dolor sit amet, consectetur adipiscing elit. Aenean interdum odio et sem fringilla, sit amet vulputate turpis sagittis. Cras non urna quam. Mauris vitae dui id ipsum varius semper. Curabitur sit amet viverra eros, ut maximus nisl. In hendrerit convallis turpis quis pulvinar. Donec porttitor faucibus ex, eget finibus velit vestibulum vitae. Donec nec nulla sollicitudin, volutpat enim interdum, sollicitudin erat.

    Curabitur fermentum tellus ac rutrum efficitur. Phasellus libero magna, efficitur rutrum mauris a, mollis convallis lectus. Sed dapibus placerat eros ut vulputate. Vivamus quis sem accumsan, laoreet enim vel, dapibus ante. Nunc bibendum faucibus metus. Aliquam volutpat dapibus erat, quis ullamcorper nisl fermentum a. Praesent vulputate neque leo, vel rutrum dui auctor in. Duis eu magna et sem ullamcorper vehicula.

    Quote With Cite

    Lorem ipsum dolor sit amet, consectetur adipiscing elit. Aenean interdum odio et sem fringilla, sit amet vulputate turpis sagittis. Cras non urna quam. Mauris vitae dui id ipsum varius semper. Curabitur sit amet viverra eros, ut maximus nisl. In hendrerit convallis turpis quis pulvinar. Donec porttitor faucibus ex, eget finibus velit vestibulum vitae. Donec nec nulla sollicitudin, volutpat enim interdum, sollicitudin erat.

    Curabitur fermentum tellus ac rutrum efficitur. Phasellus libero magna, efficitur rutrum mauris a, mollis convallis lectus. Sed dapibus placerat eros ut vulputate. Vivamus quis sem accumsan, laoreet enim vel, dapibus ante. Nunc bibendum faucibus metus. Aliquam volutpat dapibus erat, quis ullamcorper nisl fermentum a. Praesent vulputate neque leo, vel rutrum dui auctor in. Duis eu magna et sem ullamcorper vehicula.

    May or may not be a link

    Reference List

    1. Book
      1. Feldman JL
      2. Del Negro C
      3. Gray PA
      (2013) Understanding the rhythm of breathing: so near, yet so far
      In: Julius D, Clapham DE, editors. Annual Review of Physiology 75:423–452.
      https://doi.org/10.1146/annurev-physiol-040510-130049
    2. Book
      1. Geoffroy Saint-Hilaire E.
      (1818)
      Philosophie Anatomique
      Paris: Méquignon-Marvis
    3. Clinical Trial
      Scripps Wired for Health Study (Registration: 000000)
      Scripps Translational Science Institute (sponsor) (2015)
    4. Conference
      1. Jain BV
      2. Bollman B
      3. Richardson M
      4. Berger DR
      5. Helmstaedter MN
      6. Briggman KL
      7. Denk W
      8. Bowden JB
      9. Mendenhall JM
      10. Abraham WC
      11. Harris KM
      12. Kasthuri N
      13. Hayworth KJ
      14. Schalek R
      15. Tapia JC
      16. Lichtman JW
      17. Seung HS
      (2010) Boundary learning by optimization with topological constraints
      Boundary learning by optimization with topological constraints, IEEE Conference on Computer Vision and Pattern Recognition (CVPR)
      https://doi.org/10.1038/365833a0
    5. Conference
      1. Jain BV
      2. Bollman B
      3. Richardson M
      4. Berger DR
      5. Helmstaedter MN
      6. Briggman KL
      7. Denk W
      8. Bowden JB
      9. Mendenhall JM
      10. Abraham WC
      11. Harris KM
      12. Kasthuri N
      13. Hayworth KJ
      14. Schalek R
      15. Tapia JC
      16. Lichtman JW
      17. Seung HS
      (2010) Boundary learning by optimization with topological constraints
      Boundary learning by optimization with topological constraints, IEEE Conference on Computer Vision and Pattern Recognition (CVPR)
    6. Conference
      1. Jain BV
      2. Bollman B
      3. Richardson M
      4. Berger DR
      5. Helmstaedter MN
      6. Briggman KL
      7. Denk W
      8. Bowden JB
      9. Mendenhall JM
      10. Abraham WC
      11. Harris KM
      12. Kasthuri N
      13. Hayworth KJ
      14. Schalek R
      15. Tapia JC
      16. Lichtman JW
      17. Seung HS
      (2010)
      Boundary learning by optimization with topological constraints
      Boundary learning by optimization with topological constraints, IEEE Conference on Computer Vision and Pattern Recognition (CVPR)
    7. Data
      1. Bouveret R
      2. Bouveret R
      3. Schonrock N
      4. Ramialison M
      5. Doan T
      6. de Jong D
      7. Bondue A
      8. Kaur G
      9. Mohamed S
      10. Fonoudi H
      11. Chen C
      12. Wouters M
      13. Bhattacharya S
      14. Plachta N
      15. Dunwoodie SL
      16. Chapman G
      17. Blanpain C
      18. Harvey RP
      (2015) NKX2-5 mutations causative for congenital heart disease retain functionality and are directed to hundreds of targets
      NCBI Gene Expression Omnibus.
      https://doi.org/10.1038/365833a0
    8. Data
      1. Bouveret R
      2. Bouveret R
      3. Schonrock N
      4. Ramialison M
      5. Doan T
      6. de Jong D
      7. Bondue A
      8. Kaur G
      9. Mohamed S
      10. Fonoudi H
      11. Chen C
      12. Wouters M
      13. Bhattacharya S
      14. Plachta N
      15. Dunwoodie SL
      16. Chapman G
      17. Blanpain C
      18. Harvey RP
      (2015) NKX2-5 mutations causative for congenital heart disease retain functionality and are directed to hundreds of targets
      NCBI Gene Expression Omnibus.
    9. Data
      1. Bouveret R
      2. Bouveret R
      3. Schonrock N
      4. Ramialison M
      5. Doan T
      6. de Jong D
      7. Bondue A
      8. Kaur G
      9. Mohamed S
      10. Fonoudi H
      11. Chen C
      12. Wouters M
      13. Bhattacharya S
      14. Plachta N
      15. Dunwoodie SL
      16. Chapman G
      17. Blanpain C
      18. Harvey RP
      (2015)
      NKX2-5 mutations causative for congenital heart disease retain functionality and are directed to hundreds of targets
      NCBI Gene Expression Omnibus. Series accession number GSE44902
      1. Schrenk F
      2. Bromage TG
      3. Betzler CG
      4. Ring U
      5. Juwayeyi YM
      6. Schrenk F
      7. Bromage TG
      8. Betzler CG
      9. Ring U
      10. Juwayeyi YM
      11. Schrenk F
      12. Bromage TG
      13. Betzler CG
      14. Ring U
      15. Juwayeyi YM
      16. Schrenk F
      17. Bromage TG
      18. Betzler CG
      19. Ring U
      20. Juwayeyi YM
      21. Schrenk F
      22. Bromage TG
      23. Betzler CG
      24. Ring U
      25. Juwayeyi YM
      (1993) Oldest Homo and Pliocene biogeography of the Malawi rift
      Nature 365:833–836.
      https://doi.org/10.1038/365833a0
    10. Patent
      1. Patterson JB
      2. Lonergan DG
      3. Flynn GA
      4. Qingpeng Z
      5. Pallai PV
      (2011)
      IRE-1alpha inhibitors (US20100941530)
      Mankind Corp, United States patent, United States
    11. Software
      1. DeLano W. L.
      (2002)
      The Pymol Molecular Graphics System
      DeLano Scientific, Palo Alto, CA
    12. Website
      1. Crane T
      (2005) The Problem of Perception
      The Stanford Encyclopedia of Philosophy

    Section Listing

    Research categories

    1. Biochemistry
    2. Biophysics and structural biology
    3. Cancer biology
    4. Cell biology
    5. Computational and systems biology
    6. Developmental biology and stem cells
    7. Ecology
    8. Epidemiology and Global Health
    9. Genes and chromosomes
    10. Genomics and evolutionary biology
    11. Immunology
    12. Medicine
    13. Microbiology and infectious disease
    14. Neuroscience
    15. Plant biology
    Back to top

    Section Listing Home Page

    Categories

    1. Biochemistry
    2. Biophysics and structural biology
    3. Cancer biology
    4. Cell biology
    5. Computational and systems biology
    6. Developmental biology and stem cells
    7. Ecology
    8. Epidemiology and Global Health
    9. Genes and chromosomes
    10. Genomics and evolutionary biology
    11. Immunology
    12. Medicine
    13. Microbiology and infectious disease
    14. Neuroscience
    15. Plant biology
    Back to top

    Section Listing Single

    Magazine sections

    1. What we publish
    2. Editors & people
    3. Peer review
    4. Openness
    5. Reproducibility
    6. Incentives
    Back to top

    Sort Control

    Statistic

    320
    Downloads

    Statistic Not Escaped Term

    320
    Citations for
    version 1

    Jump Menu

    Login Control

    Login Control Logged In

    Main Menu

    Pager

    Pager First Page

    Pager Previous Only

    Select Nav

    Site Header Nav Bar

    Site Header Nav Bar Primary

    Site Header Nav Bar Secondary

    Site Header Title

    Site Header Title Border Variant

    Site Header Title Home Page

    Site Header Title Wrapped

    Tabbed Navigation

    Tabbed Navigation Active Tab First

    Tabbed Navigation Active Tab Fourth

    Tabbed Navigation Active Tab Second

    Tabbed Navigation Active Tab Third

    View Selector

    View Selector Article

    View Selector With Tabs

    Annotation Teaser

    [Do not use this base pattern directly: see the following variants of this pattern for usage]

    Annotation Teaser Full

    CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
    Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain
    What was the Mg2+ concentration?

    Annotation Teaser Highlight

    Clarinet (CLA-1), a novel active zone protein required for synaptic vesicle clustering and release
    Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain

    Annotation Teaser Page Note

    Gene free methodology for cell fate dynamics during development
    What was the Mg2+ concentration?

    Annotation Teaser Reply

    CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
    What was the Mg2+ concentration?
    This is a reply.

    Annotation Teaser Restricted

    Molecular basis of fatty acid taste in Drosophila
    Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain
    What was the Mg2+ concentration?
    Only me

    Annotation Teaser With Image

    CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
    Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain
    https://images.pexels.com/photos/707837/pexels-photo-707837.jpeg?w=940&h=650&auto=compress&cs=tinysrgb

    Annotation Teaser With Math

    CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
    <math xmlns="http://www.w3.org/1998/Math/MathML"><mlongdiv><mn> 12 </mn><mn> 16.5 </mn> <mn> 198 </mn> <msgroup position='1' shift='-1'> <msgroup> <mn> 12</mn> <msline length='2'/> </msgroup> <msgroup> <mn> 78</mn> <mn> 72</mn> <msline length='2'/> <mn> 6.0</mn> <mn> 6.0</mn> </msgroup> <msgroup position='-1'> <!-- extra shift to move to the right of the "." --> <msline length='3'/> <mn> 0</mn> </msgroup> </msgroup> </mlongdiv> </math>
    Long division ftw.

    Teaser

    [Do not use this base pattern directly: see the following variants of this pattern for usage]

    Teaser Main For Version Of Record

    1. Cell biology
    2. Epidemiology and Global Health
    3. Ridiculously long name that is likely to get truncated

    Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain

    Akiko Terauchi, Erin M Johnson-Venkatesh ... Hisashi Umemori
    Feedback signaling between the synapse and nucleus via FGF22 and IGF2 directs the activity-dependent stabilization of presynaptic terminals in the mouse hippocampus.

    Teaser Main For Reviewed Preprint With Updated Date

    1. Cell biology
    2. Epidemiology and Global Health
    3. Ridiculously long name that is likely to get truncated

    Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain

    Akiko Terauchi, Erin M Johnson-Venkatesh ... Hisashi Umemori
    Feedback signaling between the synapse and nucleus via FGF22 and IGF2 directs the activity-dependent stabilization of presynaptic terminals in the mouse hippocampus.
    Revised
    Reviewed Preprint v2
    Updated
    • Important
    • Compelling

    Teaser Main For Old Model Version Of Record

    1. Cell biology
    2. Epidemiology and Global Health
    3. Ridiculously long name that is likely to get truncated

    Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain

    Akiko Terauchi, Erin M Johnson-Venkatesh ... Hisashi Umemori
    Feedback signaling between the synapse and nucleus via FGF22 and IGF2 directs the activity-dependent stabilization of presynaptic terminals in the mouse hippocampus.

    Teaser Main For Research Article With Many Terms

    1. Cell biology
    2. Epidemiology and Global Health
    3. Ridiculously long name that is likely to get truncated

    Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain

    Akiko Terauchi, Erin M Johnson-Venkatesh ... Hisashi Umemori
    Feedback signaling between the synapse and nucleus via FGF22 and IGF2 directs the activity-dependent stabilization of presynaptic terminals in the mouse hippocampus.
    Version of Record
    Research Article
    • Valuable
    • Incomplete
    • Solid
    • Exceptional

    Teaser Main Small Image

    1. Cell biology
    2. Epidemiology and Global Health
    Meaningful alt text here please.

    Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain

    Akiko Terauchi, Erin M Johnson-Venkatesh ... Hisashi Umemori
    Feedback signaling between the synapse and nucleus via FGF22 and IGF2 directs the activity-dependent stabilization of presynaptic terminals in the mouse hippocampus.

    Teaser Main Big Image

    1. Cell biology
    2. Epidemiology and Global Health
    Meaningful alt text here please.

    Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain

    Akiko Terauchi, Erin M Johnson-Venkatesh ... Hisashi Umemori
    Feedback signaling between the synapse and nucleus via FGF22 and IGF2 directs the activity-dependent stabilization of presynaptic terminals in the mouse hippocampus.

    Teaser Secondary

    Teaser Secondary Small Image

    Teaser Secondary Big Image

    Teaser Basic

    Teaser Main Event

    Teaser Secondary Event

    Teaser Grid Style Labs

    An image.

    eLife Lens search

    Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.

    Teaser Grid Style Podcast

    An image.

    Multicellular life, potato blight and Hepatitis B

    Episode 24
    Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris commodo consequat.

    Teaser Main With List

    The eLife Sciences 2015 Annual Report

    The centre of the stage at eLife in 2015 was occupied by a new human ancestor 'Homo naledi' discovered by scientists in an extraordinary find in South Africa and published in eLife in two stunning papers in September. That these scientists chose to publish such ground-breaking findings in eLife is testament both to the journal's growing significance, and to the steady cultural shift towards greater transparency and collaboration in science, which lie at the heart of eLife's mission.

    Asset Viewer Inline

    [Do not use this base pattern directly: see the following variants of this pattern for usage]

    Asset Viewer Inline Main Figure Nojs

    Meaningful alt text here please.
    Many features are conserved between the mammalian nephron and planarian protonephridia.

    (A) Image of a young adult C. elegans and schematic depicting the twelve pairs of sensory neurons in the anterior amphid individuals carrying a virus with k deleterious mutations at its endemic equilibrium. class carrying the fewest number of deleterious mutations is defined as mutation class k = 0. Inset: variation in the basic reproductive rate of infected individuals (gray histogram) and variation in the net reproductive rate R of infected individuals (brown histogram) resulting from variation in the number of deleterious mutations carried by circulating viruses.

    https://doi.org/10.7554/eLife.14734

    Asset Viewer Inline Main Figure With Supplement And Additional Assets Nojs

    Figure 1 with 1 supplement see all
    Meaningful alt text here please.
    Many features are conserved between the mammalian nephron and planarian protonephridia.

    (A) Image of a young adult C. elegans and schematic depicting the twelve pairs of sensory neurons in the anterior amphid individuals carrying a virus with k deleterious mutations at its endemic equilibrium. class carrying the fewest number of deleterious mutations is defined as mutation class k = 0. Inset: variation in the basic reproductive rate of infected individuals (gray histogram) and variation in the net reproductive rate R of infected individuals (brown histogram) resulting from variation in the number of deleterious mutations carried by circulating viruses.

    https://doi.org/10.7554/eLife.14734
    How should this optional heading be styled?
    Table 1 - source data 1.

    Is the species name mentioned in the title, impact statement, abstract and digest of eLife papers

    some more details here
    https://doi.org/10.7554/eLife.10181.001
    Table 1 - source data 1.

    Is the species name mentioned in the title, impact statement, abstract and digest of eLife papers

    some more details here
    https://doi.org/10.7554/eLife.10181.002

    Asset Viewer Inline Main Figure With Supplement And Additional Assets

    Figure 1 with 1 supplement see all
    Meaningful alt text here please.
    Many features are conserved between the mammalian nephron and planarian protonephridia.

    (A) Image of a young adult C. elegans and schematic depicting the twelve pairs of sensory neurons in the anterior amphid individuals carrying a virus with k deleterious mutations at its endemic equilibrium. class carrying the fewest number of deleterious mutations is defined as mutation class k = 0. Inset: variation in the basic reproductive rate of infected individuals (gray histogram) and variation in the net reproductive rate R of infected individuals (brown histogram) resulting from variation in the number of deleterious mutations carried by circulating viruses.

    https://doi.org/10.7554/eLife.14734
    How should this optional heading be styled?
    Table 1 - source data 1.

    Is the species name mentioned in the title, impact statement, abstract and digest of eLife papers

    some more details here
    https://doi.org/10.7554/eLife.10181.001
    Table 1 - source data 1.

    Is the species name mentioned in the title, impact statement, abstract and digest of eLife papers

    some more details here
    https://doi.org/10.7554/eLife.10181.002

    Asset Viewer Inline Supplementary Figure Nojs

    Figure 1 supplement 1
    Meaningful alt text here please.
    Many features are conserved between the mammalian nephron and planarian protonephridia.

    (A) Image of a young adult C. elegans and schematic depicting the twelve pairs of sensory neurons in the anterior amphid individuals carrying a virus with k deleterious mutations at its endemic equilibrium. class carrying the fewest number of deleterious mutations is defined as mutation class k = 0. Inset: variation in the basic reproductive rate of infected individuals (gray histogram) and variation in the net reproductive rate R of infected individuals (brown histogram) resulting from variation in the number of deleterious mutations carried by circulating viruses.

    https://doi.org/10.7554/eLife.14734

    Asset Viewer Inline Supplementary Figure With Additional Assets Nojs

    Figure 1 supplement 2
    Meaningful alt text here please.
    Many features are conserved between the mammalian nephron and planarian protonephridia.

    (A) Image of a young adult C. elegans and schematic depicting the twelve pairs of sensory neurons in the anterior amphid individuals carrying a virus with k deleterious mutations at its endemic equilibrium. class carrying the fewest number of deleterious mutations is defined as mutation class k = 0. Inset: variation in the basic reproductive rate of infected individuals (gray histogram) and variation in the net reproductive rate R of infected individuals (brown histogram) resulting from variation in the number of deleterious mutations carried by circulating viruses.

    https://doi.org/10.7554/eLife.14734
    How should this optional heading be styled?
    Table 1 - source data 1.

    Is the species name mentioned in the title, impact statement, abstract and digest of eLife papers

    some more details here
    https://doi.org/10.7554/eLife.10181.001
    Table 1 - source data 1.

    Is the species name mentioned in the title, impact statement, abstract and digest of eLife papers

    some more details here
    https://doi.org/10.7554/eLife.10181.002
    How should this optional heading be styled?
    Table 1 - source data 1.

    Is the species name mentioned in the title, impact statement, abstract and digest of eLife papers

    some more details here
    https://doi.org/10.7554/eLife.10181.001
    Table 1 - source data 1.

    Is the species name mentioned in the title, impact statement, abstract and digest of eLife papers

    some more details here
    https://doi.org/10.7554/eLife.10181.002

    Asset Viewer Inline Table Nojs

    Table 1
    Many features are conserved between the mammalian nephron and planarian protonephridia.

    (A) Image of a young adult C. elegans and schematic depicting the twelve pairs of sensory neurons in the anterior amphid individuals carrying a virus with k deleterious mutations at its endemic equilibrium. class carrying the fewest number of deleterious mutations is defined as mutation class k = 0. Inset: variation in the basic reproductive rate of infected individuals (gray histogram) and variation in the net reproductive rate R of infected individuals (brown histogram) resulting from variation in the number of deleterious mutations carried by circulating viruses.

    https://doi.org/10.7554/eLife.14734
    F(Dfn, Dfd)Partial η2Original effect size fReplication total sample sizeDetectable effect size f
    F(24,39) = 0.8678 (interaction)0.3481200.7307699169*0.3895070†
    F(2,39) = 0.8075 (treatments)0.0397660.2035014169*0.2415459†
    F(12,39) = 187.6811 (hematology parameters)0.9829787.599178169*0.3331365‡

    Asset Viewer Inline Tables Nojs

    Table 1
    Many features are conserved between the mammalian nephron and planarian protonephridia.

    (A) Image of a young adult C. elegans and schematic depicting the twelve pairs of sensory neurons in the anterior amphid individuals carrying a virus with k deleterious mutations at its endemic equilibrium. class carrying the fewest number of deleterious mutations is defined as mutation class k = 0. Inset: variation in the basic reproductive rate of infected individuals (gray histogram) and variation in the net reproductive rate R of infected individuals (brown histogram) resulting from variation in the number of deleterious mutations carried by circulating viruses.

    https://doi.org/10.7554/eLife.14734
    F(Dfn, Dfd)Partial η2Original effect size fReplication total sample sizeDetectable effect size f
    F(24,39) = 0.8678 (interaction)0.3481200.7307699169*0.3895070†
    F(2,39) = 0.8075 (treatments)0.0397660.2035014169*0.2415459†
    F(12,39) = 187.6811 (hematology parameters)0.9829787.599178169*0.3331365‡
    F(Dfn, Dfd)Partial η2Original effect size fReplication total sample sizeDetectable effect size f
    F(24,39) = 0.8678 (interaction)0.3481200.7307699169*0.3895070†
    F(2,39) = 0.8075 (treatments)0.0397660.2035014169*0.2415459†
    F(12,39) = 187.6811 (hematology parameters)0.9829787.599178169*0.3331365‡

    Asset Viewer Inline Video Nojs

    Video 1
    Many features are conserved between the mammalian nephron and planarian protonephridia.

    (A) Image of a young adult C. elegans and schematic depicting the twelve pairs of sensory neurons in the anterior amphid individuals carrying a virus with k deleterious mutations at its endemic equilibrium. class carrying the fewest number of deleterious mutations is defined as mutation class k = 0. Inset: variation in the basic reproductive rate of infected individuals (gray histogram) and variation in the net reproductive rate R of infected individuals (brown histogram) resulting from variation in the number of deleterious mutations carried by circulating viruses.

    https://doi.org/10.7554/eLife.14734

    About Profiles

    Leadership team

    1. Randy Scheckman

      Editor-in-Chief

      Lorem ipsum dolor sit amet, consectetur adipiscing elit. Mauris tempor euismod mi. Morbi facilisis eros in mi consequat cursus. Nulla malesuada pretium mauris, vitae gravida diam laoreet ac. Curabitur ornare libero sed porta molestie. Ut ut sem in libero tincidunt lobortis. Nullam eros nisi, malesuada vitae leo sit amet, bibendum congue justo. Morbi iaculis lectus erat, vel dapibus metus posuere sit amet. Phasellus eget scelerisque massa. Mauris hendrerit ex in nisl ultricies elementum. Donec tellus risus, rhoncus molestie rutrum et, cursus eget mi. Praesent et elit tellus. Curabitur id sodales turpis. Fusce pulvinar aliquam commodo. Cras vitae dolor vitae metus dignissim auctor.Cras nulla purus, rhoncus et mollis in, imperdiet sed metus. In non porttitor nibh. In sit amet ipsum eget nisl laoreet tincidunt. Donec iaculis nibh quis lacus viverra sagittis. Phasellus imperdiet congue imperdiet.

      Interdum et malesuada fames ac ante ipsum primis in faucibus. Nunc nisi tortor, rhoncus.

      Expertise
      Cell Biology
      Competing interests statement
      Donec tellus
    2. Eve Marder

      Deputy Editor

      Lorem ipsum dolor sit amet, consectetur adipiscing elit. Mauris tempor euismod mi. Morbi facilisis eros in mi consequat cursus. Nulla malesuada pretium mauris, vitae gravida diam laoreet ac. Curabitur ornare libero sed porta molestie. Ut ut sem in libero tincidunt lobortis. Nullam eros nisi, malesuada vitae leo sit amet, bibendum congue justo. Morbi iaculis lectus erat, vel dapibus metus posuere sit amet. Phasellus eget scelerisque massa. Mauris hendrerit ex in nisl ultricies elementum. Donec tellus risus, rhoncus molestie rutrum et, cursus eget mi. Praesent et elit tellus. Curabitur id sodales turpis. Fusce pulvinar aliquam commodo. Cras vitae dolor vitae metus dignissim auctor.Cras nulla purus, rhoncus et mollis in, imperdiet sed metus. In non porttitor nibh. In sit amet ipsum eget nisl laoreet tincidunt. Donec iaculis nibh quis lacus viverra sagittis. Phasellus imperdiet congue imperdiet.

      Interdum et malesuada fames ac ante ipsum primis in faucibus. Nunc nisi tortor, rhoncus.

      Expertise
      Cell Biology
      Competing interests statement
      Donec tellus
    3. Profile (no image)

      Deputy Editor

      Lorem ipsum dolor sit amet, consectetur adipiscing elit. Mauris tempor euismod mi. Morbi facilisis eros in mi consequat cursus. Nulla malesuada pretium mauris, vitae gravida diam laoreet ac. Curabitur ornare libero sed porta molestie. Ut ut sem in libero tincidunt lobortis. Nullam eros nisi, malesuada vitae leo sit amet, bibendum congue justo. Morbi iaculis lectus erat, vel dapibus metus posuere sit amet. Phasellus eget scelerisque massa. Mauris hendrerit ex in nisl ultricies elementum. Donec tellus risus, rhoncus molestie rutrum et, cursus eget mi. Praesent et elit tellus. Curabitur id sodales turpis. Fusce pulvinar aliquam commodo. Cras vitae dolor vitae metus dignissim auctor.Cras nulla purus, rhoncus et mollis in, imperdiet sed metus. In non porttitor nibh. In sit amet ipsum eget nisl laoreet tincidunt. Donec iaculis nibh quis lacus viverra sagittis. Phasellus imperdiet congue imperdiet.

      Interdum et malesuada fames ac ante ipsum primis in faucibus. Nunc nisi tortor, rhoncus.

      Expertise
      Cell Biology
      Competing interests statement
      Donec tellus

    About Profiles Compact

    Reviewing editors

    1. Editor name

      University of California, Los Angeles (United States)

      Research focus
      Pre-mRNA splicing
      post-transcriptional gene regulation
      Experimental organism
      Human
      Mouse
    2. Editor name

      University of California, Los Angeles (United States)

    3. Editor name

      University of California, Los Angeles (United States)

      Research focus
      Pre-mRNA splicing
      post-transcriptional gene regulation
      Experimental organism
      Human
      Mouse
    4. Editor name

      University of California, Los Angeles (United States)

      Research focus
      Pre-mRNA splicing
      post-transcriptional gene regulation
      Experimental organism
      Human
      Mouse

    Additional Assets

    How should this optional heading be styled?
    Table 1 - source data 1.

    Is the species name mentioned in the title, impact statement, abstract and digest of eLife papers (July–Sept 2014)?

    some more details here
    https://example.com/a-non-doi-link
    Table 1 - source data 1.

    Is the species name mentioned in the title, impact statement, abstract and digest of eLife papers (July–Sept 2014)?

    some more details here
    https://doi.org/10.7554/eLife.10181.001

    Box

    Box 2.

    Widespread connectivity is not dependent on instrumentation and analyses.

    This is an h1

    This is an h2

    This is an h3

    This is an h4

    This is an h5
    This is an h6

    This is a paragraph. It's a bit longer that the other things in this pattern so you can see how the wrapping works, which you can't really do unless you've got enough content. Right, that should do it. Onward!

    Figure 1 with 1 supplement see all
    Meaningful alt text here please.
    Many features are conserved between the mammalian nephron and planarian protonephridia.

    (A) Image of a young adult C. elegans and schematic depicting the twelve pairs of sensory neurons in the anterior amphid individuals carrying a virus with k deleterious mutations at its endemic equilibrium. class carrying the fewest number of deleterious mutations is defined as mutation class k = 0. Inset: variation in the basic reproductive rate of infected individuals (gray histogram) and variation in the net reproductive rate R of infected individuals (brown histogram) resulting from variation in the number of deleterious mutations carried by circulating viruses.

    https://doi.org/10.7554/eLife.14734
    https://doi.org/10.7554/eLife.03952.016

    Content Aside

    Content Aside Complete

    Content Aside Correction

    Content Aside Status Title Long

    Content Aside Status Title Short

    Content Aside Timeline Poa

    Content Aside Timeline Vor New Latest Active

    Content Aside Timeline Vor New Not Latest Active

    Content Aside Timeline Vor Old Latest Active

    Content Aside Timeline Vor Old Not Latest Active

    Content Aside With Status Buttons And Metrics

    Decision Letter Header

    eLife posts the editorial decision letter and author response on a selection of the published articles (subject to the approval of the authors). An edited version of the letter sent to the authors after peer review is shown, indicating the substantive concerns or comments; minor concerns are not usually shown. Reviewers have the opportunity to discuss the decision before the letter is sent (see review process). Similarly, the author response typically shows only responses to the major concerns raised by the reviewers.

    Decision Letter Header With Profiles

    1. Meaningful alt text here please.
      Oliver Hobert
      Reviewing Editor
      Colombia University, USA
    2. Meaningful alt text here please.
      Oliver Hobert
      Reviewing Editor
      Colombia University, USA

    eLife posts the editorial decision letter and author response on a selection of the published articles (subject to the approval of the authors). An edited version of the letter sent to the authors after peer review is shown, indicating the substantive concerns or comments; minor concerns are not usually shown.

    Reviewers have the opportunity to discuss the decision before the letter is sent (see review process). Similarly, the author response typically shows only responses to the major concerns raised by the reviewers.

    Filter Panel

    Refine your results by:

    Research categories

    Grid Listing

    Grid Listing First Page

    1. An image.

      eLife Lens search

      Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
    2. An image.

      eLife Lens search

      Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
    3. An image.

      eLife Lens search

      Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
    4. An image.

      eLife Lens search

      Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
    5. An image.

      eLife Lens search

      Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
    6. An image.

      eLife Lens search

      Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
    7. An image.

      eLife Lens search

      Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
    8. An image.

      eLife Lens search

      Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
    9. An image.

      eLife Lens search

      Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.

    Grid Listing Labs Teasers

    1. An image.

      eLife Lens search

      Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
    2. An image.

      eLife Lens search

      Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
    3. An image.

      eLife Lens search

      Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
    4. An image.

      eLife Lens search

      Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
    5. An image.

      eLife Lens search

      Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
    6. An image.

      eLife Lens search

      Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
    7. An image.

      eLife Lens search

      Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
    8. An image.

      eLife Lens search

      Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
    9. An image.

      eLife Lens search

      Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.

    Grid Listing Pager

    1. An image.

      eLife Lens search

      Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
    2. An image.

      eLife Lens search

      Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
    3. An image.

      eLife Lens search

      Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
    4. An image.

      eLife Lens search

      Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
    5. An image.

      eLife Lens search

      Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
    6. An image.

      eLife Lens search

      Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
    7. An image.

      eLife Lens search

      Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
    8. An image.

      eLife Lens search

      Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.
    9. An image.

      eLife Lens search

      Lorem ipsum dolor sit amet,consectetur adipiscing elit. Pellentesque sem enim, pretium non risus non, molestie.

    Grid Listing Podcast Teasers

    1. An image.

      Multicellular life, potato blight and Hepatitis B

      Episode 24
      Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris commodo consequat.
    2. An image.

      Multicellular life, potato blight and Hepatitis B

      Episode 24
      Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris commodo consequat.
    3. An image.

      Multicellular life, potato blight and Hepatitis B

      Episode 24
      Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris commodo consequat.
    4. An image.

      Multicellular life, potato blight and Hepatitis B

      Episode 24
      Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris commodo consequat.
    5. An image.

      Multicellular life, potato blight and Hepatitis B

      Episode 24
      Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris commodo consequat.
    6. An image.

      Multicellular life, potato blight and Hepatitis B

      Episode 24
      Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris commodo consequat.
    7. An image.

      Multicellular life, potato blight and Hepatitis B

      Episode 24
      Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris commodo consequat.
    8. An image.

      Multicellular life, potato blight and Hepatitis B

      Episode 24
      Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris commodo consequat.
    9. An image.

      Multicellular life, potato blight and Hepatitis B

      Episode 24
      Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris commodo consequat.
    10. An image.

      Multicellular life, potato blight and Hepatitis B

      Episode 24
      Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris commodo consequat.
    11. An image.

      Multicellular life, potato blight and Hepatitis B

      Episode 24
      Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris commodo consequat.
    12. An image.

      Multicellular life, potato blight and Hepatitis B

      Episode 24
      Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris commodo consequat.

    Highlight

    Highlight Full

    Highlights

    Highlight One Item

    Highlights

    Highlight Six Items

    Highlights

    Highlight Two Items

    Highlights

    Listing Annotation Teasers

    Annotations

    1. CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
      Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain
      What was the Mg2+ concentration?
    2. Clarinet (CLA-1), a novel active zone protein required for synaptic vesicle clustering and release
      Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain
    3. Gene free methodology for cell fate dynamics during development
      What was the Mg2+ concentration?
    4. CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
      What was the Mg2+ concentration?
      This is a reply.
    5. Molecular basis of fatty acid taste in Drosophila
      Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain
      What was the Mg2+ concentration?
      Only me
    6. CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
      Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain
      https://images.pexels.com/photos/707837/pexels-photo-707837.jpeg?w=940&h=650&auto=compress&cs=tinysrgb
    7. CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
      <math xmlns="http://www.w3.org/1998/Math/MathML"><mlongdiv><mn> 12 </mn><mn> 16.5 </mn> <mn> 198 </mn> <msgroup position='1' shift='-1'> <msgroup> <mn> 12</mn> <msline length='2'/> </msgroup> <msgroup> <mn> 78</mn> <mn> 72</mn> <msline length='2'/> <mn> 6.0</mn> <mn> 6.0</mn> </msgroup> <msgroup position='-1'> <!-- extra shift to move to the right of the "." --> <msline length='3'/> <mn> 0</mn> </msgroup> </msgroup> </mlongdiv> </math>
      Long division ftw.
    8. CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
      Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain
      https://www.youtube.com/watch?v=oHg5SJYRHA0

    Listing Annotation Teasers First Page

    Annotations

    1. CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
      Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain
      What was the Mg2+ concentration?
    2. Clarinet (CLA-1), a novel active zone protein required for synaptic vesicle clustering and release
      Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain
    3. Gene free methodology for cell fate dynamics during development
      What was the Mg2+ concentration?
    4. CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
      What was the Mg2+ concentration?
      This is a reply.
    5. Molecular basis of fatty acid taste in Drosophila
      Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain
      What was the Mg2+ concentration?
      Only me
    6. CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
      Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain
      https://images.pexels.com/photos/707837/pexels-photo-707837.jpeg?w=940&h=650&auto=compress&cs=tinysrgb
    7. CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
      <math xmlns="http://www.w3.org/1998/Math/MathML"><mlongdiv><mn> 12 </mn><mn> 16.5 </mn> <mn> 198 </mn> <msgroup position='1' shift='-1'> <msgroup> <mn> 12</mn> <msline length='2'/> </msgroup> <msgroup> <mn> 78</mn> <mn> 72</mn> <msline length='2'/> <mn> 6.0</mn> <mn> 6.0</mn> </msgroup> <msgroup position='-1'> <!-- extra shift to move to the right of the "." --> <msline length='3'/> <mn> 0</mn> </msgroup> </msgroup> </mlongdiv> </math>
      Long division ftw.
    8. CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
      Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain
      https://www.youtube.com/watch?v=oHg5SJYRHA0

    Listing Annotation Teasers Pager

    Annotations

    1. CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
      Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain
      What was the Mg2+ concentration?
    2. Clarinet (CLA-1), a novel active zone protein required for synaptic vesicle clustering and release
      Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain
    3. Gene free methodology for cell fate dynamics during development
      What was the Mg2+ concentration?
    4. CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
      What was the Mg2+ concentration?
      This is a reply.
    5. Molecular basis of fatty acid taste in Drosophila
      Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain
      What was the Mg2+ concentration?
      Only me
    6. CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
      Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain
      https://images.pexels.com/photos/707837/pexels-photo-707837.jpeg?w=940&h=650&auto=compress&cs=tinysrgb
    7. CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
      <math xmlns="http://www.w3.org/1998/Math/MathML"><mlongdiv><mn> 12 </mn><mn> 16.5 </mn> <mn> 198 </mn> <msgroup position='1' shift='-1'> <msgroup> <mn> 12</mn> <msline length='2'/> </msgroup> <msgroup> <mn> 78</mn> <mn> 72</mn> <msline length='2'/> <mn> 6.0</mn> <mn> 6.0</mn> </msgroup> <msgroup position='-1'> <!-- extra shift to move to the right of the "." --> <msline length='3'/> <mn> 0</mn> </msgroup> </msgroup> </mlongdiv> </math>
      Long division ftw.
    8. CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
      Retrograde fibroblast growth factor 22 (FGF22) signaling regulates insulin-like growth factor 2 (IGF2) expression for activity-dependent synapse stabilization in the mammalian brain
      https://www.youtube.com/watch?v=oHg5SJYRHA0

    Listing Profile Snippets

    Listing of profile snippets

    1. Meaningful alt text here please.
      Prabhat Jha
      University of Toronto
    2. Meaningful alt text here please.
      Richard Losick
      Harvard University
    3. See more things!

    Listing Read More

    Further reading

      1. Cell Biology
      2. Epidemiology and Global Health
      Lee R Berger
      Research article

      Optimal decision-making requires balancing fast but error-prone and more accurate but slower decisions through adjustments of decision thresholds. Here, we demonstrate two distinct correlates of such speed-accuracy adjustments by recording subthalamic nucleus (STN) activity and electroencephalography in 11 Parkinson’s disease patients during a perceptual decision-making task; STN low-frequency oscillatory (LFO) activity (2–8 Hz), coupled to activity at prefrontal electrode Fz, and STN beta activity (13–30 Hz) coupled to electrodes C3/C4 close to motor cortex. These two correlates differed not only in their cortical topography and spectral characteristics but also in the relative timing of recruitment and in their precise relationship with decision thresholds. Increases of STN LFO power preceding the response predicted increased thresholds only after accuracy instructions, while cue-induced reductions of STN beta power decreased thresholds irrespective of instructions. These findings indicate that distinct neural mechanisms determine whether a decision will be made in haste or with caution.

      1. Cell Biology
      2. Epidemiology and Global Health
      Lee R Berger
      Research article

      Optimal decision-making requires balancing fast but error-prone and more accurate but slower decisions through adjustments of decision thresholds.

    Listing Read More First Page

    Further reading

      1. Cell Biology
      2. Epidemiology and Global Health
      Lee R Berger
      Research article

      Optimal decision-making requires balancing fast but error-prone and more accurate but slower decisions through adjustments of decision thresholds. Here, we demonstrate two distinct correlates of such speed-accuracy adjustments by recording subthalamic nucleus (STN) activity and electroencephalography in 11 Parkinson’s disease patients during a perceptual decision-making task; STN low-frequency oscillatory (LFO) activity (2–8 Hz), coupled to activity at prefrontal electrode Fz, and STN beta activity (13–30 Hz) coupled to electrodes C3/C4 close to motor cortex. These two correlates differed not only in their cortical topography and spectral characteristics but also in the relative timing of recruitment and in their precise relationship with decision thresholds. Increases of STN LFO power preceding the response predicted increased thresholds only after accuracy instructions, while cue-induced reductions of STN beta power decreased thresholds irrespective of instructions. These findings indicate that distinct neural mechanisms determine whether a decision will be made in haste or with caution.

      1. Cell Biology
      2. Epidemiology and Global Health
      Lee R Berger
      Research article

      Optimal decision-making requires balancing fast but error-prone and more accurate but slower decisions through adjustments of decision thresholds.

    Listing Teasers

    Listing of teasers

      1. Microbiology and Infectious Disease
      Meaningful alt text please.

      Quorum sensing control of Type VI secretion factors restricts the proliferation of quorum-sensing mutants

      Charlotte Majerczyk, Emily Schneider, E Peter Greenberg
      Quorum-sensing control of Burkholderia thailandensis toxin and immunity pairs serves to police quorum-sensing mutants and may represent a general strategy whereby cooperators can police mutants.
    1. Mapping global environmental suitability for Zika virus

      Jane P Messina, Moritz UG Kraemer ... Simon I Hay
    2. Meaningful alt text please.

      The global antigenic diversity of swine influenza A viruses

      Nicola S Lewis, Colin A Russell ... Amy L Vincent
      Swine populations worldwide are sporadically infected by influenza viruses from humans and birds leading to geographically heterogeneous swine influenza virus populations that pose epizootic and pandemic threats.

    Listing Teasers First Page

    Listing of teasers

      1. Microbiology and Infectious Disease
      Meaningful alt text please.

      Quorum sensing control of Type VI secretion factors restricts the proliferation of quorum-sensing mutants

      Charlotte Majerczyk, Emily Schneider, E Peter Greenberg
      Quorum-sensing control of Burkholderia thailandensis toxin and immunity pairs serves to police quorum-sensing mutants and may represent a general strategy whereby cooperators can police mutants.
    1. Mapping global environmental suitability for Zika virus

      Jane P Messina, Moritz UG Kraemer ... Simon I Hay
    2. Meaningful alt text please.

      The global antigenic diversity of swine influenza A viruses

      Nicola S Lewis, Colin A Russell ... Amy L Vincent
      Swine populations worldwide are sporadically infected by influenza viruses from humans and birds leading to geographically heterogeneous swine influenza virus populations that pose epizootic and pandemic threats.

    Listing Teasers Highlights

    Highlights controls:

    Listing Teasers Pager

    Listing of teasers

      1. Microbiology and Infectious Disease
      Meaningful alt text please.

      Quorum sensing control of Type VI secretion factors restricts the proliferation of quorum-sensing mutants

      Charlotte Majerczyk, Emily Schneider, E Peter Greenberg
      Quorum-sensing control of Burkholderia thailandensis toxin and immunity pairs serves to police quorum-sensing mutants and may represent a general strategy whereby cooperators can police mutants.
    1. Mapping global environmental suitability for Zika virus

      Jane P Messina, Moritz UG Kraemer ... Simon I Hay
    2. Meaningful alt text please.

      The global antigenic diversity of swine influenza A viruses

      Nicola S Lewis, Colin A Russell ... Amy L Vincent
      Swine populations worldwide are sporadically infected by influenza viruses from humans and birds leading to geographically heterogeneous swine influenza virus populations that pose epizootic and pandemic threats.

    Read More Item

    1. Cell Biology
    2. Epidemiology and Global Health
    Lee R Berger
    Research article

    Optimal decision-making requires balancing fast but error-prone and more accurate but slower decisions through adjustments of decision thresholds. Here, we demonstrate two distinct correlates of such speed-accuracy adjustments by recording subthalamic nucleus (STN) activity and electroencephalography in 11 Parkinson’s disease patients during a perceptual decision-making task; STN low-frequency oscillatory (LFO) activity (2–8 Hz), coupled to activity at prefrontal electrode Fz, and STN beta activity (13–30 Hz) coupled to electrodes C3/C4 close to motor cortex. These two correlates differed not only in their cortical topography and spectral characteristics but also in the relative timing of recruitment and in their precise relationship with decision thresholds. Increases of STN LFO power preceding the response predicted increased thresholds only after accuracy instructions, while cue-induced reductions of STN beta power decreased thresholds irrespective of instructions. These findings indicate that distinct neural mechanisms determine whether a decision will be made in haste or with caution.

  • Statistic Collection

    • 54,741
      views
    • 320
      downloads
    • 89
      citations

    Content Header Journal

    [Do not use this base pattern directly: see the following variants of this pattern for usage]

    • CommentOpen annotations (there are currently 0 annotations on this page).

    Content Header Journal Article 1 Author

    Content Header Journal Article 2 Authors

    Homo naledi, a new species of the genus Homo from the Dinaledi Chamber, South Africa

    1. Lee R Berger  Is a corresponding author
    2. Bernhard Zipfel  Is a corresponding author
    1. University of the Witwatersrand, South Africa
    2. Smithsonian Institution, United States

    Content Header Journal Article

    Homo naledi, a new species of the genus Homo from the Dinaledi Chamber, South Africa

    1. Lee R Berger  Is a corresponding author
    2. John Hawks
    3. Darryl J de Ruiter
    4. Steven E Churchill
    5. Peter Schmid
    6. Lucas K Delezene
    7. Tracy L Kivell
    8. Heather M Garvin
    9. Scott A Williams
    10. Jeremy M DeSilva
    11. Matthew M Skinner
    12. Charles M Musiba
    13. Noel Cameron
    14. Trenton W Holliday
    15. William Harcourt-Smith
    16. Rebecca R Ackermann
    17. Markus Bastir
    18. Barry Bogin
    19. Debra Bolter
    20. Juliet Brophy
    21. Zachary D Cofran
    22. Kimberly A Congdon
    23. Andrew S Deane
    24. Mana Dembo
    25. Michelle Drapeau
    26. Marina C Elliott
    27. Elen M Feuerriegel
    28. Daniel Garcia-Martinez
    29. David J Green
    30. Alia Gurtov
    31. Joel D Irish
    32. Ashley Kruger
    33. Myra F Laird
    34. Damiano Marchi
    35. Marc R Meyer
    36. Shahed Nalla
    37. Enquye W Negash
    38. Caley M Orr
    39. Davorka Radovcic
    40. Lauren Schroeder
    41. Jill E Scott
    42. Zachary Throckmorton
    43. Caroline VanSickle
    44. Christopher S Walker
    45. Pianpian Wei
    46. Bernhard Zipfel  Is a corresponding author
    1. University of the Witwatersrand, South Africa
    2. University of Wisconsin-Madison, United States
    3. Texas A&M University, United States
    4. Duke University, United States
    5. University of Zurich, Switzerland
    6. University of Arkansas, United States
    7. University of Kent, United Kingdom
    8. Max Planck Institute for Evolutionary Anthropology, Germany
    9. Mercyhurst University, United States
    10. New York University, United States
    11. New York Consortium in Evolutionary Primatology, United States
    12. Dartmouth College, United States
    13. University of Colorado Denver, United States
    14. Loughborough University, United Kingdom
    15. Tulane University, United States
    16. Lehman College, United States
    17. American Museum of Natural History, United States
    18. University of Cape Town, South Africa
    19. Museo Nacional de Ciencias Naturales, Spain
    20. Modesto Junior College, United States
    21. Louisiana State University, United States
    22. Nazarbayev University, Kazakhstan
    23. University of Missouri, United States
    24. University of Kentucky College of Medicine, United States
    25. Simon Fraser University, Canada
    26. Université de Montréal, Canada
    27. Australian National University, Australia
    28. Biology Department, Universidad Autònoma de Madrid, Spain
    29. Midwestern University, United States
    30. Liverpool John Moores University, United Kingdom
    31. University of Pisa, Italy
    32. Chaffey College, United States
    33. University of Johannesburg, South Africa
    34. George Washington University, United States
    35. University of Colorado School of Medicine, United States
    36. Croatian Natural History Museum, Croatia
    37. University of Iowa, United States
    38. Lincoln Memorial University, United States
    39. Smithsonian Institution, United States

    Content Header Journal Digest No Social

    Holding the focus

    A new open source software tool makes it possible for researchers to view cells in living animals in high detail.

    Content Header Journal Digest

    Holding the focus

    A new open source software tool makes it possible for researchers to view cells in living animals in high detail.

    Content Header Journal Has Aside

    Homo naledi, a new species of the genus Homo from the Dinaledi Chamber, South Africa

    1. Lee R Berger  Is a corresponding author
    2. John Hawks
    3. Darryl J de Ruiter
    4. Steven E Churchill
    5. Peter Schmid
    6. Lucas K Delezene
    7. Tracy L Kivell
    8. Heather M Garvin
    9. Scott A Williams
    10. Jeremy M DeSilva
    11. Matthew M Skinner
    12. Charles M Musiba
    13. Noel Cameron
    14. Trenton W Holliday
    15. William Harcourt-Smith
    16. Rebecca R Ackermann
    17. Markus Bastir
    18. Barry Bogin
    19. Debra Bolter
    20. Juliet Brophy
    21. Zachary D Cofran
    22. Kimberly A Congdon
    23. Andrew S Deane
    24. Mana Dembo
    25. Michelle Drapeau
    26. Marina C Elliott
    27. Elen M Feuerriegel
    28. Daniel Garcia-Martinez
    29. David J Green
    30. Alia Gurtov
    31. Joel D Irish
    32. Ashley Kruger
    33. Myra F Laird
    34. Damiano Marchi
    35. Marc R Meyer
    36. Shahed Nalla
    37. Enquye W Negash
    38. Caley M Orr
    39. Davorka Radovcic
    40. Lauren Schroeder
    41. Jill E Scott
    42. Zachary Throckmorton
    43. Caroline VanSickle
    44. Christopher S Walker
    45. Pianpian Wei
    46. Bernhard Zipfel  Is a corresponding author
    1. University of the Witwatersrand, South Africa
    2. University of Wisconsin-Madison, United States
    3. Texas A&M University, United States
    4. Duke University, United States
    5. University of Zurich, Switzerland
    6. University of Arkansas, United States
    7. University of Kent, United Kingdom
    8. Max Planck Institute for Evolutionary Anthropology, Germany
    9. Mercyhurst University, United States
    10. New York University, United States
    11. New York Consortium in Evolutionary Primatology, United States
    12. Dartmouth College, United States
    13. University of Colorado Denver, United States
    14. Loughborough University, United Kingdom
    15. Tulane University, United States
    16. Lehman College, United States
    17. American Museum of Natural History, United States
    18. University of Cape Town, South Africa
    19. Museo Nacional de Ciencias Naturales, Spain
    20. Modesto Junior College, United States
    21. Louisiana State University, United States
    22. Nazarbayev University, Kazakhstan
    23. University of Missouri, United States
    24. University of Kentucky College of Medicine, United States
    25. Simon Fraser University, Canada
    26. Université de Montréal, Canada
    27. Australian National University, Australia
    28. Biology Department, Universidad Autònoma de Madrid, Spain
    29. Midwestern University, United States
    30. Liverpool John Moores University, United Kingdom
    31. University of Pisa, Italy
    32. Chaffey College, United States
    33. University of Johannesburg, South Africa
    34. George Washington University, United States
    35. University of Colorado School of Medicine, United States
    36. Croatian Natural History Museum, Croatia
    37. University of Iowa, United States
    38. Lincoln Memorial University, United States
    39. Smithsonian Institution, United States

    Content Header Journal Inside Elife Article

    2022 eLife Community Ambassadors: Ready for action

    After completing their learning, awareness and community-building phase, our global group of early-career researchers are now eager to make change across research culture.

    Content Header Journal Magazine

    Genetic Engineering: Increasing the uptake of carbon dioxide

    A mechanism for concentrating carbon dioxide has for the first time been successfully transferred into a species that lacks such a process.

    Content Header Profile

    Kananinoheaokuuhomeopuukaimanaalohilo

    • University of West of Nowhere
    • University of Middle of Nowhere
    • University of East of Nowhere

    Content Header Read More

    1. Cell Biology
    2. Epidemiology and Global Health
    Lee R Berger
    Research article

    Content Header Simple

    Browse our latest research

    Page 2 of 20

    Content Header

    Alerts and feeds

    Content Header About People With Breadcrumb

    Our mission

    eLife is committed to bringing about real change in the way the results of research are reviewed and communicated.

    Content Header Background With Audio Player

    Epidemiology and Global Health

    Flatworms have organs called protonephridia that could be used as a model system for the study of kidney disease.
    Research Article

    Content Header Background With Image Credit And Audio Player

    Epidemiology and Global Health

    Flatworms have organs called protonephridia that could be used as a model system for the study of kidney disease.
    Research Article
    I haz image credit with a link.

    Content Header Background With Image Credit Overlay

    Epidemiology and Global Health

    Flatworms have organs called protonephridia that could be used as a model system for the study of kidney disease.
    Research Article
    I haz image credit with a link.

    Content Header Background With Image Credit

    Epidemiology and Global Health

    Flatworms have organs called protonephridia that could be used as a model system for the study of kidney disease.
    Research Article
    I haz image credit with a link.

    Content Header Background

    Epidemiology and Global Health

    Flatworms have organs called protonephridia that could be used as a model system for the study of kidney disease.
    Research Article

    Content Header Collection Title 0 Xx Short

    Magazine

    From its earliest days, eLife has been publishing important advances in our understanding of Cancer Biology. Here, eLife Senior Editors present a collection of great papers spanning from oncogenes and tumor suppressors.
    Collection

    Content Header Collection Title 1 X Short

    Scientist and Parent

    From its earliest days, eLife has been publishing important advances in our understanding of Cancer Biology. Here, eLife Senior Editors present a collection of great papers spanning from oncogenes and tumor suppressors.
    Collection

    Content Header Collection Title 2 Short

    Reproducibility Project: Cancer Biology

    From its earliest days, eLife has been publishing important advances in our understanding of Cancer Biology. Here, eLife Senior Editors present a collection of great papers spanning from oncogenes and tumor suppressors.
    Collection

    Content Header Collection Title 3 Medium A

    Reproducibility Project: Cancer Biology

    From its earliest days, eLife has been publishing important advances in our understanding of Cancer Biology. Here, eLife Senior Editors present a collection of great papers spanning from oncogenes and tumor suppressors.
    Collection

    Content Header Collection Title 3 Medium B

    Mechanistic Microbiome Studies: A Special Issue

    From its earliest days, eLife has been publishing important advances in our understanding of Cancer Biology. Here, eLife Senior Editors present a collection of great papers spanning from oncogenes and tumor suppressors.
    Collection

    Content Header Collection Title 4 Long

    eLife's Multi-format Plain-language Summaries of Research

    From its earliest days, eLife has been publishing important advances in our understanding of Cancer Biology. Here, eLife Senior Editors present a collection of great papers spanning from oncogenes and tumor suppressors.
    Collection

    Content Header Collection Title 5 X Long A

    Ezrin enrichment on curved membranes requires a specific conformation or interaction with a curvature-sensitive partner

    From its earliest days, eLife has been publishing important advances in our understanding of Cancer Biology. Here, eLife Senior Editors present a collection of great papers spanning from oncogenes and tumor suppressors.
    Collection

    Content Header Collection Title 5 X Long B

    Kasugamycin potentiates rifampicin and limits emergence of resistance in Mycobacterium tuberculosis by specifically decreasing mycobacterial mistranslation

    From its earliest days, eLife has been publishing important advances in our understanding of Cancer Biology. Here, eLife Senior Editors present a collection of great papers spanning from oncogenes and tumor suppressors.
    Collection

    Content Header Collection Title 6 Xx Long

    A title in an image-backed content header like this should never be this long Ridiculous! However if it is, at least we can scale appropriately and prevent things from breaking in a really horrible fashion

    From its earliest days, eLife has been publishing important advances in our understanding of Cancer Biology. Here, eLife Senior Editors present a collection of great papers spanning from oncogenes and tumor suppressors.
    Collection

    Content Header Listing

    eLife podcast

    Flatworms have organs called protonephridia that could be used as a model system for the study of kidney disease.

    Content Header Non Article With Select

    People

    The working scientists who serve as eLife editors, our early-career advisors, governing board, and our executive staff all work in concert to realise eLife’s mission to accelerate discovery

    Content Header Non Article

    Annual report: 2016 in review

    A look back at eLife's achievements in 2016, notably in advocating for more open practises in sciences, building an open infrastructure for research communication and supporting early-career researchers.
    Inside eLife

    Content Header Podcast

    Download icon

    Episode 2: July 2013

    In this issue of the eLife podcast we discuss plants performing arithmetic division, the evolutionary dynamics of cancer, single-molecule measurements in the immune system, why blood vessels don’t grow in the retina.

    Email Cta

    Site Header